ID: 1196119294

View in Genome Browser
Species Human (GRCh38)
Location X:112031300-112031322
Sequence CATTCAAGGCAGGGACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196119294_1196119301 19 Left 1196119294 X:112031300-112031322 CCCTCCAGTCCCTGCCTTGAATG 0: 1
1: 0
2: 2
3: 17
4: 345
Right 1196119301 X:112031342-112031364 TCCCTGCTCTACTCAAACCAAGG 0: 1
1: 1
2: 2
3: 19
4: 175
1196119294_1196119304 24 Left 1196119294 X:112031300-112031322 CCCTCCAGTCCCTGCCTTGAATG 0: 1
1: 0
2: 2
3: 17
4: 345
Right 1196119304 X:112031347-112031369 GCTCTACTCAAACCAAGGACAGG 0: 1
1: 0
2: 0
3: 1
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196119294 Original CRISPR CATTCAAGGCAGGGACTGGA GGG (reversed) Intronic
901469697 1:9447827-9447849 CATCCACAGCAGGGACGGGATGG - Intergenic
901717017 1:11163773-11163795 CATTTAAAGCAGGGTGTGGAGGG + Intronic
902144368 1:14385464-14385486 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
902149513 1:14431680-14431702 CATTCAAGGCAGGAAGAAGAAGG - Intergenic
904754694 1:32761651-32761673 TCTTCGAGGCAGGTACTGGAAGG - Intronic
908457547 1:64318922-64318944 AATTCAAGGAAGGGTCTAGAAGG - Intergenic
910088931 1:83438693-83438715 TCTTAAAGGCAGGGTCTGGACGG + Intergenic
910157128 1:84232072-84232094 CATTCAAAGCAGTGTGTGGAGGG - Intronic
910540005 1:88344694-88344716 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
911932638 1:103924331-103924353 CATTCAAAGCAGGGTGTAGAGGG + Intergenic
912637332 1:111309563-111309585 CATTACAGGCAAGGAGTGGAGGG + Intronic
913917511 1:124791858-124791880 CATTCAACTCACGGAGTGGAAGG + Intergenic
913923504 1:124862518-124862540 CATTCAACTCACGGAGTGGAAGG + Intergenic
913924350 1:124873228-124873250 CATTCAACTCACGGAGTGGAAGG + Intergenic
913924845 1:124879348-124879370 CATTCAACTCACGGAGTGGAAGG + Intergenic
913925452 1:124887003-124887025 CATTCAACTCACGGAGTGGAAGG + Intergenic
913925697 1:124890066-124890088 CATTCAACTCACGGAGTGGAAGG + Intergenic
913926688 1:124902311-124902333 CATTCAACTCACGGAGTGGAAGG + Intergenic
913926917 1:124905372-124905394 CATTCAACTCACGGAGTGGAAGG + Intergenic
913927162 1:124908434-124908456 CATTCAACTCACGGAGTGGAAGG + Intergenic
913927406 1:124911497-124911519 CATTCAACTCACGGAGTGGAAGG + Intergenic
913927529 1:124913029-124913051 CATTCAACTCACGGAGTGGAAGG + Intergenic
913928019 1:124919148-124919170 CATTCAACTCACGGAGTGGAAGG + Intergenic
913928506 1:124925273-124925295 CATTCAACTCACGGAGTGGAAGG + Intergenic
913928747 1:124928336-124928358 CATTCAACTCACGGAGTGGAAGG + Intergenic
913928868 1:124929869-124929891 CATTCAACTCACGGAGTGGAAGG + Intergenic
914996828 1:152550944-152550966 CATTCAAAGCAGTGTGTGGAGGG - Intronic
915760498 1:158306920-158306942 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
915929103 1:160047669-160047691 CATTCTGGGCAGGGATGGGAGGG - Intronic
916652248 1:166843246-166843268 AACTCATGGCAGGGAGTGGAAGG + Intronic
917824988 1:178809780-178809802 CAATCGAGGCAGGGGCTGCATGG + Intronic
919654963 1:200188342-200188364 CATTCAAAGCAGGGTGTAGAGGG + Intergenic
920004514 1:202823194-202823216 AGTTCTAGGCATGGACTGGAGGG + Intronic
920192443 1:204202235-204202257 CATCCAGGGGAGGGACTGGAGGG - Intronic
920678791 1:208057397-208057419 CTTTCAAGGAAGGGACAGTATGG + Intronic
920681880 1:208079303-208079325 CAGTCGAGCCAGGGGCTGGAAGG + Exonic
920898741 1:210085011-210085033 CATTCTAGGCAGTGCCTGCATGG - Intronic
921380598 1:214520673-214520695 CAGTAAAAGCGGGGACTGGAGGG - Intronic
921985375 1:221306607-221306629 CATTCCAGGTGGGGACTGTATGG - Intergenic
922909802 1:229205997-229206019 CAAGCCAGGCTGGGACTGGATGG + Intergenic
923210760 1:231802217-231802239 CATTCAAGGGAGGGACCTGGTGG + Intronic
924668833 1:246102552-246102574 CATTCCAAGAAGGGACTGTAGGG - Intronic
1062815023 10:493093-493115 CAGTCTTGCCAGGGACTGGAAGG - Intronic
1062851572 10:746939-746961 CATTCAAAGCAGTGTCTAGAGGG + Intergenic
1064886371 10:20117485-20117507 CATTCAAGGCAGACAGTTGATGG + Intronic
1065722896 10:28643370-28643392 CGCACAAGGCAGGGCCTGGAAGG - Intergenic
1066433051 10:35371140-35371162 CCTTCAAAGCAGGGACTATATGG + Intronic
1067301248 10:45012324-45012346 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1069370475 10:67742491-67742513 CATTCAAGGCAGTGTGTGGAGGG + Intergenic
1069757411 10:70781786-70781808 CATCCAAGGTAGGGCCTGGCTGG - Exonic
1069776535 10:70930385-70930407 TATCCAAGGCAGGGACTGAGGGG - Intergenic
1069955501 10:72048594-72048616 TTTTCAAGTCAGGGAGTGGATGG - Intergenic
1070329810 10:75409057-75409079 CAGTCATCGCGGGGACTGGATGG + Intergenic
1073131703 10:101193236-101193258 GATTCATGGCGGGGACTAGAGGG + Intergenic
1073273382 10:102286865-102286887 CATACAAGGCAGCCACTGTAAGG - Intronic
1074259215 10:111834990-111835012 GAATTAAGGCAGGGACTGAAAGG + Intergenic
1075125909 10:119698658-119698680 CACTCACAGCAGGGGCTGGAGGG + Intergenic
1075445364 10:122509329-122509351 CCGTCAAGGGAGCGACTGGAGGG + Intronic
1075930673 10:126292671-126292693 CAGTCATGACAGGGACTGTATGG - Intronic
1076259067 10:129051253-129051275 CATACAAGGAAGGAACTGCAAGG - Intergenic
1076305867 10:129465683-129465705 CATCCAAGGCAGGGTCGGGGTGG + Intergenic
1077161775 11:1116755-1116777 AATACAAGCCAGGGAGTGGAAGG + Intergenic
1077818736 11:5714572-5714594 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1078082084 11:8211434-8211456 CATCCAAGGCAGGGGAGGGAGGG + Intergenic
1078868849 11:15325306-15325328 CTTTTAGGGCAGGGACAGGAAGG - Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1080622619 11:33999278-33999300 CATTCTTGGCTGGCACTGGAAGG - Intergenic
1081172867 11:39890229-39890251 CATTCAAAGCAGTGAGTAGAGGG + Intergenic
1082667226 11:55988858-55988880 CATTCAAAGCAGGGTGTAGAGGG + Intergenic
1083061579 11:59878273-59878295 TATTCAGGGCTGGGAATGGAAGG - Intergenic
1084873672 11:72115045-72115067 CCTTGAGGGCAGGGACTGAATGG + Intronic
1086687258 11:89747041-89747063 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1087286559 11:96270743-96270765 CATTACAGGAAGGTACTGGAGGG - Intronic
1087568708 11:99896211-99896233 CAGTGAAGGCAGGGACTTGTGGG - Intronic
1088781536 11:113138934-113138956 TATGCTAGGCAGAGACTGGAGGG - Intronic
1089171217 11:116512903-116512925 CATTCCAGGCAGGGGCTTGTGGG + Intergenic
1089218252 11:116849063-116849085 GTTTCAAGGCTGGGACTGGGAGG + Intronic
1089353250 11:117833402-117833424 CCTGGATGGCAGGGACTGGAGGG - Intronic
1089573098 11:119422953-119422975 CTTTCCAGGCAGGGGCGGGAGGG - Intronic
1089715294 11:120353508-120353530 TATTCCAGGAAGGGACTGGATGG - Intronic
1091576061 12:1736764-1736786 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1092064589 12:5579351-5579373 TGTTCAGGGCAGGGACTGAATGG + Intronic
1092237360 12:6818682-6818704 CACTCAAGGGAGAGACAGGAAGG + Intronic
1094237565 12:28186293-28186315 CACACAGGGCAGGGACTGTATGG - Intronic
1099279811 12:80629556-80629578 CAAGCAAGGTGGGGACTGGAAGG + Intronic
1099737517 12:86588892-86588914 CATTCAAAGCAGTGAGTAGAGGG + Intronic
1099836949 12:87918955-87918977 TAATGGAGGCAGGGACTGGAGGG - Intergenic
1100334911 12:93619791-93619813 CATTCCAGGCAGGAATGGGAGGG - Intergenic
1103932888 12:124459934-124459956 CATTCCAGGCAGGGAACGGTAGG - Intronic
1105926129 13:25010423-25010445 CATTCAAAGCAGGGTATAGAGGG - Intergenic
1106357426 13:28997046-28997068 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1107034617 13:35887535-35887557 CTTTCAAGGAAGAGACTGGGTGG + Intronic
1107403900 13:40095435-40095457 CATGAGAAGCAGGGACTGGATGG + Intergenic
1111004647 13:82231987-82232009 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1113293960 13:108937843-108937865 CATTCAAAGCATGGATTGCAAGG - Intronic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1115069240 14:29301411-29301433 CACTCATGGTAGGGGCTGGAGGG - Intergenic
1116618976 14:47174638-47174660 CATTCAAAGCAGTGAGTAGATGG + Intronic
1117465677 14:55991338-55991360 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1117468342 14:56017166-56017188 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1118326722 14:64786372-64786394 CATTCAGGGCTGGGACAGGCGGG - Intronic
1121151904 14:91643361-91643383 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1121438766 14:93935660-93935682 CATGCAAGCCTGGGGCTGGAGGG + Intronic
1121637183 14:95461818-95461840 CTTTCAGAGCAGGGACTGGGAGG + Intronic
1121782020 14:96628032-96628054 CATGCAGGGCTGGGACAGGACGG + Intergenic
1202846374 14_GL000009v2_random:180985-181007 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1202915838 14_GL000194v1_random:171587-171609 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1124076832 15:26454131-26454153 CCCTCAAGGCAGGCACTGGTGGG - Intergenic
1126872378 15:53003381-53003403 AATTCAAGGCAGCCACTGCAGGG + Intergenic
1127151876 15:56084193-56084215 CAACCAAGGCAGGGTCAGGAAGG + Intergenic
1127309066 15:57736039-57736061 CATTCTATTCAGGGACTGGGAGG - Intronic
1127635510 15:60865728-60865750 CAATGCAGGCTGGGACTGGAAGG - Intronic
1127682447 15:61310909-61310931 CACTCAAGGCAGAGATGGGAAGG + Intergenic
1127778717 15:62292042-62292064 CATTTAAAGCAGGGTGTGGAGGG - Intergenic
1127790895 15:62397876-62397898 CATCTAAGCCAGGGATTGGATGG - Intronic
1129183741 15:73893166-73893188 GATTCAAGGAAGGGACTGAAGGG + Intergenic
1131116933 15:89801645-89801667 CCTGGATGGCAGGGACTGGAGGG - Intronic
1131258951 15:90878718-90878740 CATTCAAGATTGGGACTTGAGGG - Intronic
1131634090 15:94211430-94211452 CATTCAAAGCAGGGTGTAGAGGG - Intergenic
1133055035 16:3141625-3141647 CATTCCTGGCAGGGACAGCAGGG + Exonic
1134611517 16:15612845-15612867 AACTCAAGCCAGGGACTGCAGGG - Intronic
1135986796 16:27189916-27189938 CCTTCAAGCCAGGGACAGGCTGG + Intergenic
1136559808 16:31032694-31032716 GATGCAAGGCAGGGGCTGGGGGG + Intergenic
1137224778 16:46492830-46492852 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1137228508 16:46538335-46538357 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1137378863 16:47979102-47979124 CATTCAAAGCAGTTACTGGCTGG + Intergenic
1138087011 16:54142495-54142517 CATTCTAGGCAGAGACTTGGGGG + Intergenic
1138732178 16:59207383-59207405 CATACTAGGCAAGCACTGGAGGG + Intergenic
1138858496 16:60725341-60725363 CCTCAAAGGCAGGCACTGGAAGG - Intergenic
1139970367 16:70770426-70770448 CTTTCATGGCAGGGACGAGAAGG - Intronic
1140788192 16:78363857-78363879 AGTTCGAGGCAGGGCCTGGATGG + Intronic
1143705847 17:8697217-8697239 GGATCAAGGCAGGGACAGGAGGG + Intergenic
1144384727 17:14738760-14738782 CATCCCAGGCTGGGATTGGATGG - Intergenic
1145786740 17:27598556-27598578 CACTCAATGCAGGGAGGGGAGGG - Intronic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1147171212 17:38620140-38620162 GATTCAGGGCTGGGCCTGGACGG - Intergenic
1148044124 17:44732061-44732083 CATCCATGGGAGGGACTGCAGGG - Intronic
1148087052 17:45000617-45000639 CAGGCAAGGCAGGGACAGGATGG + Intergenic
1149962130 17:61122389-61122411 CATTTAAGCCAGTGTCTGGATGG - Intronic
1150032910 17:61759062-61759084 CATTCAAGGTAGGTATTGAAAGG - Intronic
1150222698 17:63506251-63506273 CACACAAGGTAGGGACTGGGTGG - Intronic
1151668322 17:75558094-75558116 CACTCAAGGCAGGCAGGGGATGG + Intronic
1151926463 17:77201210-77201232 CCTGCAAGGCAGGGTATGGAAGG - Intronic
1152192097 17:78894866-78894888 AATACAAGGTACGGACTGGAAGG + Intronic
1157860730 18:51138096-51138118 CATTCAAGGCAGGGATGGGCGGG + Intergenic
1158409485 18:57192765-57192787 CTTTCAGGGCATGGCCTGGAAGG + Intergenic
1158846966 18:61454406-61454428 CATTCCAGACAGGTCCTGGAAGG - Intronic
1159349517 18:67253619-67253641 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1159963966 18:74578285-74578307 CATTCATGTGAGGGACTAGACGG - Exonic
1161349081 19:3782714-3782736 CACTCAAGGCCTGGGCTGGAAGG + Intronic
1161397229 19:4051362-4051384 CATTCAAGGTAGGGCTTTGAGGG - Intronic
1162306776 19:9879516-9879538 CATTCATGGCAGGGGGTGAAAGG - Intronic
1163542706 19:17920750-17920772 CATTCAAGGCAGAAACAAGAGGG + Intergenic
1165076679 19:33283302-33283324 CACCCAAGGCAGGGACTGGGTGG + Intergenic
1165600476 19:37051871-37051893 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1166440328 19:42808604-42808626 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1168706508 19:58473294-58473316 CCTTCATGGCAGGGACAGAAAGG + Exonic
925564085 2:5230617-5230639 CATTCAACGCTGGGACTGGCTGG + Intergenic
927709303 2:25315041-25315063 CACTCAAGGCAGGGGCTTGGCGG - Intronic
928481518 2:31689115-31689137 CATTCAAGTCAAAGCCTGGAAGG - Intergenic
928578469 2:32680621-32680643 GAGTCAGGGTAGGGACTGGATGG + Intronic
928625884 2:33139575-33139597 CTTTCTAGGCAGGGACAGCAAGG - Intronic
929430844 2:41885039-41885061 CAGTGAAGTCAGGAACTGGAAGG - Intergenic
929941499 2:46337401-46337423 TATTCCAGGCAGGGAGTGGGAGG + Intronic
932293982 2:70609189-70609211 TGTTCAAGGCAGGAAGTGGAAGG - Intronic
932864691 2:75329150-75329172 CATTCAAAGCAGTGTCTAGAGGG + Intergenic
933184627 2:79265327-79265349 CAGTCAAGGAAAGGACTAGAAGG + Intronic
934232789 2:90200836-90200858 CATCCAGGGAAGTGACTGGATGG + Intergenic
934919314 2:98330124-98330146 CTTCCAAGGGAGGGACTGCATGG + Intergenic
935050392 2:99520393-99520415 CATTCAAAGCAGGGTGTGGTCGG + Intergenic
935421775 2:102877178-102877200 CATTCAAAGCAGTGAGTAGAGGG - Intergenic
937095399 2:119232225-119232247 GCTTGAATGCAGGGACTGGATGG + Intronic
937281343 2:120719479-120719501 CATTCCAGGATGGGTCTGGAAGG + Intergenic
938069995 2:128303253-128303275 CAGTAAAGGCAGGGCCAGGAGGG + Intronic
938207569 2:129437339-129437361 CATTGAAGGAAGGGCCTGGAGGG + Intergenic
938535182 2:132234176-132234198 CATTCAAAGCAGGGTGTAGAGGG + Intronic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
940981548 2:160009220-160009242 AATTGAAAGCAGGGACTCGAAGG + Intronic
942070590 2:172312256-172312278 CATGCAGGGCAGGAACCGGAGGG - Intergenic
942859146 2:180588780-180588802 CATTCAAAGCAGCGTCTAGAGGG - Intergenic
943698828 2:190967002-190967024 CATTAAAGGCAGAGACTGGGGGG + Intronic
945197838 2:207253846-207253868 TCTGTAAGGCAGGGACTGGAGGG + Intergenic
945659724 2:212671022-212671044 CATTATAGGCAGTGAATGGAAGG - Intergenic
948373110 2:237503261-237503283 CTGCCAAGGCAGGGCCTGGAGGG + Intronic
1169000270 20:2163349-2163371 CCAACAAAGCAGGGACTGGAGGG - Intronic
1171582229 20:26471924-26471946 CATTCAAGTCACAGAATGGAAGG + Intergenic
1171969182 20:31552792-31552814 CATTCAAGGCAGGAAGAGGCAGG + Intronic
1172849056 20:37947540-37947562 CATACAAGGCTGGTTCTGGAAGG + Intergenic
1174106014 20:48162779-48162801 CATTCAAGGCAGGCTTTCGATGG + Intergenic
1174284707 20:49464528-49464550 CTTTTCAGGCAGGGAGTGGAGGG - Intronic
1174933424 20:54841314-54841336 CATTCATGGCAGGCACAGAAAGG - Intergenic
1176635191 21:9186234-9186256 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1177159247 21:17529909-17529931 TAGTAAAGGAAGGGACTGGAAGG - Intronic
1177856691 21:26407696-26407718 CTTTCATGGCAGGGAAGGGAAGG - Intergenic
1179522187 21:41953058-41953080 CAGGCAAGGCAGGTACTGGCTGG + Intronic
1180239744 21:46493902-46493924 AATCCAAGGCAGGGCATGGATGG - Intronic
1180414957 22:12700562-12700584 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1183238784 22:36640325-36640347 CTTTCAAAGCAAGGGCTGGAGGG + Intronic
1183265219 22:36820726-36820748 CTTTGAAGGCAGGGAGTGTAGGG + Intergenic
949519949 3:4842089-4842111 GATTAAAGGCTGGCACTGGAAGG - Intronic
950370389 3:12524488-12524510 CAGACAAGGTAGAGACTGGAGGG - Intronic
950980123 3:17294642-17294664 CATTGCATGCAGTGACTGGATGG - Intronic
952969637 3:38642823-38642845 CATAAAAGGCGAGGACTGGAAGG + Intronic
953084346 3:39652366-39652388 CATGCAAGTCAGGGACAGGCTGG - Intergenic
953106607 3:39887179-39887201 CATTCAAAGCAGGGTGTAGAGGG + Intronic
953475764 3:43204693-43204715 CATTCAAGGCAAGTTCTGGTTGG + Intergenic
953629144 3:44597547-44597569 CATTCCAAGCAGGGTTTGGAAGG + Exonic
953877590 3:46675142-46675164 CCTGCAAGGCAGTGACAGGAAGG + Intronic
954485815 3:50850422-50850444 AATTCAAAGCATGGACTGTAAGG - Intronic
954680603 3:52344046-52344068 CAATCATGGCAGCGCCTGGAAGG - Intronic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
954919330 3:54175992-54176014 AACTCAGGGAAGGGACTGGAGGG + Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955970275 3:64432194-64432216 CAGTCAAGGGAGGGAATGTACGG - Intronic
956719900 3:72108534-72108556 CTTTCAAGACAGTGACTGCATGG - Intergenic
957521049 3:81318984-81319006 GATTCTAGGCAAGGACTGGGGGG + Intergenic
958108124 3:89104120-89104142 CATTCAAGCCAGGAATTGAAAGG + Intergenic
959778881 3:110204172-110204194 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
959986146 3:112573511-112573533 CATAGAAGGCAGGTACTGTATGG - Intronic
960154057 3:114279736-114279758 CATTCAAAGCAGTGTGTGGAGGG + Intronic
965243127 3:166229290-166229312 CATTCAAAGCAGGGTGTAGAGGG + Intergenic
965645951 3:170881713-170881735 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
967273568 3:187751234-187751256 CATTCAAGGGAAGGAAGGGAGGG + Intergenic
968388583 4:169004-169026 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
969443148 4:7228965-7228987 CACTCGGGGCAGGGACGGGACGG - Intronic
969532478 4:7737449-7737471 CCATCAAGGCAGGGAAAGGACGG + Intronic
970120886 4:12751121-12751143 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
972946915 4:44267384-44267406 CATTCAAGGCAGTGTGTAGAGGG + Intronic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974562092 4:63535377-63535399 CATTCAAAGCAGTGTCTAGAGGG + Intergenic
977084055 4:92571873-92571895 CATTCAAGGCAGTGTGTGGAAGG + Intronic
977391191 4:96412349-96412371 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
977703451 4:100046677-100046699 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
978064224 4:104376521-104376543 CATTCAAAGCAGTGTCTAGAGGG + Intergenic
978068770 4:104439995-104440017 CATTCAAAGCAGTGTCTAGAGGG + Intergenic
978088876 4:104690039-104690061 CATTCAAAGCAGTGTCTAGAGGG - Intergenic
979150618 4:117310069-117310091 AATTCAAGGCATGGACTGCAAGG - Intergenic
979315095 4:119252885-119252907 CATTTAAGGCAGTGTGTGGAAGG - Intronic
979573403 4:122256451-122256473 CATGCAAGGCTGGGAATGAAAGG + Intronic
980507021 4:133737086-133737108 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
981161742 4:141507041-141507063 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
981439961 4:144771530-144771552 CATTCAAAGCAGGGTGTAGAGGG + Intergenic
981644290 4:146980906-146980928 CATTCAAGGCTAGGACAGGCTGG - Intergenic
981714724 4:147741542-147741564 ATTTTCAGGCAGGGACTGGATGG + Intronic
981987572 4:150875919-150875941 AATTCAAAGCATGGACTGCAAGG + Intronic
982200571 4:152956594-152956616 GATTCAAGGCAGTGCCTGGATGG - Intronic
983971661 4:173882886-173882908 CGTTCCAGGCAGAGACTGTAAGG + Intergenic
986128263 5:4903897-4903919 CATTGAAGGGAGAGACAGGAAGG - Intergenic
987595057 5:19987511-19987533 CATTTAAGGCAGGGATTCGTGGG + Intronic
988604605 5:32668690-32668712 CAGTCAAGGCAGGGGCTCCAGGG - Intergenic
989655584 5:43744368-43744390 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
991561388 5:67957452-67957474 AATTCAAGGGAGCGACTGAAAGG - Intergenic
991949440 5:71933338-71933360 CTTTGAAGGAAGGAACTGGAGGG - Intergenic
992104243 5:73436936-73436958 CATGCGAGGCCGGGACGGGAGGG - Intergenic
993296971 5:86153200-86153222 CAAACTAGGCAGGAACTGGAGGG + Intergenic
994307348 5:98222736-98222758 CATTCAAAGCAGTGTCTAGAGGG + Intergenic
995162701 5:109000493-109000515 CATTCAAAGCAGGGTGTAGAGGG + Intronic
995585461 5:113643701-113643723 CACTGAAGGCAGGGATTGGGAGG + Intergenic
995750114 5:115444933-115444955 CATTTAAAGCAGGGAGTAGAGGG + Intergenic
995822351 5:116250992-116251014 CACTTAAGGCAGGAACTGGTAGG - Intronic
996385001 5:122901699-122901721 CATCCAAGGGAGAGAATGGAGGG - Intronic
997365329 5:133321819-133321841 CATTCAAGGCATGGACGTCAAGG - Intronic
998391414 5:141789166-141789188 GTTTCAGTGCAGGGACTGGAAGG - Intergenic
998803450 5:145894123-145894145 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1001541846 5:172545288-172545310 CCTCTCAGGCAGGGACTGGAAGG - Intergenic
1001898338 5:175400624-175400646 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1002638232 5:180618534-180618556 CAGACAAGGCAGGCAGTGGAGGG - Intronic
1002712206 5:181202134-181202156 CTGTCAAGGCAGGGAATTGAAGG - Intronic
1008122971 6:47638779-47638801 CATTTAAAGCAGGGAGTAGAGGG - Intergenic
1008524647 6:52396096-52396118 CTTTAAAGGCAGGGACTGTTAGG - Intronic
1009206385 6:60806637-60806659 CATTCAAAGCAGGGTGTAGAGGG - Intergenic
1009362335 6:62829838-62829860 CATTCAAAGCAGGGTGTAGAGGG - Intergenic
1010362892 6:75015292-75015314 CATTCAAAGCAGGGTGTAGAGGG + Intergenic
1010384810 6:75267705-75267727 CATTTATTACAGGGACTGGAAGG + Exonic
1011184360 6:84657923-84657945 CATGGAAGGCAGGTACTGAAAGG - Intergenic
1011376460 6:86692533-86692555 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1013387672 6:109648079-109648101 CATTCAAAGCAGTGAGTAGAGGG + Intronic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1016491488 6:144609027-144609049 CATTCAAGGCAGTTACTGATAGG - Intronic
1018192360 6:161321261-161321283 AATTAAATGCATGGACTGGAAGG - Intergenic
1018452656 6:163923448-163923470 CAGCCATGGCAGGCACTGGAAGG - Intergenic
1020736047 7:11950345-11950367 CAGTGAAGGGAGGGACTGGGTGG + Intergenic
1022477920 7:30723805-30723827 CAATGAGGGCAGGGGCTGGAGGG + Intronic
1022696479 7:32710988-32711010 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1024634200 7:51274077-51274099 CACTTAAGGCATGGACTGGGGGG - Intronic
1028275962 7:88857101-88857123 CATTCAAAGCAGTGCGTGGAGGG + Intronic
1028307934 7:89290064-89290086 CATCCCAGTTAGGGACTGGAAGG - Intronic
1028416686 7:90587947-90587969 CATTCTAGGTAGGGACTGGAAGG - Intronic
1029535911 7:101157555-101157577 CTTCCAGGGCAGAGACTGGAGGG - Intronic
1030458047 7:109797959-109797981 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1030851562 7:114492563-114492585 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1031377363 7:121043708-121043730 CCTACAAGGCAGTGACTGGCTGG - Intronic
1031453741 7:121954340-121954362 AATGCAAGGCAGTGAGTGGAGGG - Intronic
1033072054 7:138212408-138212430 CCTTCAAGGCAGGGACTGGTGGG + Intergenic
1034999383 7:155600538-155600560 CAGACAAGCCAGGGACTGGAAGG + Intergenic
1035946338 8:3967638-3967660 AATTGTAGGCAGGGAATGGAGGG - Intronic
1037638746 8:20723413-20723435 CAGTCCAGGCAGTGAGTGGATGG - Intergenic
1038026459 8:23595315-23595337 AATCCAAGGCAGGGACTGGCTGG + Intergenic
1038116512 8:24561679-24561701 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1038225952 8:25658092-25658114 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1039568491 8:38567537-38567559 CATTGGAGGCAGGGACCAGATGG - Intergenic
1039724214 8:40197876-40197898 AATTCAAGGGAAGGAGTGGAGGG - Intergenic
1040086414 8:43347589-43347611 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1040992984 8:53371975-53371997 CATTCAAAGCAGGGTGTAGAGGG + Intergenic
1041067494 8:54096344-54096366 AATTCCAGGGAGGGACTGGGAGG + Intronic
1041286087 8:56263536-56263558 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1042624143 8:70738621-70738643 CATTCAAGGCAGTGTATAGAGGG - Intronic
1043498197 8:80825916-80825938 CATTTAAAGCAGTGTCTGGAGGG + Intronic
1044239650 8:89873987-89874009 TATTCAAAGGAGGGACTGTAGGG - Intergenic
1047837498 8:128710222-128710244 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1048457464 8:134591131-134591153 CACTCAACGCAGGGATTGCATGG + Intronic
1048565931 8:135597208-135597230 AATGGATGGCAGGGACTGGAGGG + Intronic
1051527360 9:18061111-18061133 CTCTCAAGGCAGGGGTTGGAGGG + Intergenic
1051584665 9:18714089-18714111 CATTCAAGGCAGTGTGTAGAGGG + Intronic
1051597715 9:18842189-18842211 CATTCAAAGCAGTGACTAGAGGG - Intronic
1052239350 9:26252623-26252645 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1052645366 9:31227662-31227684 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1055103984 9:72493457-72493479 CATTTAAGGTAGAGAGTGGATGG - Intergenic
1055333224 9:75205783-75205805 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1055556692 9:77481200-77481222 CATTCAAAGCAGTGAGTAGAGGG - Intronic
1057646831 9:96884341-96884363 CCTTCATGACAGGGCCTGGAGGG - Intergenic
1057833507 9:98425877-98425899 CATTCAGGGCAGGTCCGGGAAGG + Intronic
1057965776 9:99501593-99501615 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1058335502 9:103823358-103823380 CATTCATGGCAGGAAGTGAAGGG + Intergenic
1059454150 9:114389069-114389091 CATTCAAATAAGGCACTGGAAGG + Intronic
1060659347 9:125394706-125394728 GTGTCAAGGCAGGGACTAGATGG + Intergenic
1060796379 9:126515137-126515159 CACTCCAGCCAGGGACTGGAGGG - Intergenic
1060801234 9:126547161-126547183 GTGTCATGGCAGGGACTGGAGGG - Intergenic
1061948761 9:133924152-133924174 AATTCAAAGCAGGGTCTTGAAGG + Intronic
1203757970 Un_GL000218v1:153541-153563 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1203338818 Un_KI270302v1:629-651 CATTCAACTCACGGAGTGGAAGG + Intergenic
1203339272 Un_KI270305v1:1125-1147 CATTCAACTCACGGAGTGGAAGG + Intergenic
1203339862 Un_KI270320v1:853-875 CATTCAACTCACGGATTGGAAGG + Intergenic
1203339988 Un_KI270320v1:2390-2412 CATTCAACTCACGGAGTGGAAGG + Intergenic
1203340114 Un_KI270320v1:3918-3940 CATTCAACTCACGGAGTGGAAGG + Intergenic
1203339407 Un_KI270322v1:1256-1278 CATTCAACTCACGGAGTGGAAGG - Intergenic
1186386768 X:9117825-9117847 CATACCAGCCAGGGACAGGAAGG - Intronic
1187102185 X:16205053-16205075 CATTCAAGTCAGCTCCTGGAAGG + Intergenic
1188494656 X:30770916-30770938 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189256675 X:39645234-39645256 CATTCAAATCAGGGCCTGGCAGG + Intergenic
1190601106 X:52093777-52093799 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1191118081 X:56871963-56871985 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191134781 X:57051894-57051916 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191681186 X:63841620-63841642 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191782264 X:64881505-64881527 CATTCAAAGCAGTGAGTAGAGGG + Intergenic
1191804663 X:65121794-65121816 CATTCAAAGCAGTGAGTAGAGGG - Intergenic
1191811314 X:65191952-65191974 CATTCAAGGCAGTGTGTAGAGGG - Intergenic
1191890847 X:65938766-65938788 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1192712090 X:73601550-73601572 CATTCAAAGCAGTGTGTGGAGGG + Intronic
1192842913 X:74876142-74876164 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1193002397 X:76577603-76577625 CATTCAAGGCAGTGTGTAGAGGG - Intergenic
1193164056 X:78261795-78261817 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1195441821 X:104907454-104907476 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1195553301 X:106192693-106192715 CATTCAAAGCAGGGTGTAGAGGG - Intronic
1196119294 X:112031300-112031322 CATTCAAGGCAGGGACTGGAGGG - Intronic
1199284833 X:146044173-146044195 GATTCATGCCAGGGACTAGAAGG - Intergenic
1199414945 X:147571045-147571067 AATTCAAAGCAGGGATTGCAAGG + Intergenic
1200098256 X:153674103-153674125 CGGTGAAGGCAGAGACTGGAAGG - Exonic
1200179603 X:154142377-154142399 AATGGAAGGCAGGGTCTGGAAGG - Intergenic
1200784962 Y:7252711-7252733 CATTCAAGGCAGTGTGTAGAGGG - Intergenic
1201346355 Y:12989060-12989082 CATTCAAAGCAGGGTGTAGAGGG - Intergenic
1201570550 Y:15409094-15409116 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic