ID: 1196120507

View in Genome Browser
Species Human (GRCh38)
Location X:112045381-112045403
Sequence CACTACCTCCAGAGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 9, 2: 40, 3: 169, 4: 589}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196120507_1196120513 9 Left 1196120507 X:112045381-112045403 CCCTAGAGCCTCTGGAGGTAGTG 0: 1
1: 9
2: 40
3: 169
4: 589
Right 1196120513 X:112045413-112045435 TGACAGTGATTTTGGCCCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 169
1196120507_1196120511 1 Left 1196120507 X:112045381-112045403 CCCTAGAGCCTCTGGAGGTAGTG 0: 1
1: 9
2: 40
3: 169
4: 589
Right 1196120511 X:112045405-112045427 GGCCTTGCTGACAGTGATTTTGG 0: 1
1: 0
2: 4
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196120507 Original CRISPR CACTACCTCCAGAGGCTCTA GGG (reversed) Intronic
900469328 1:2845329-2845351 CACTCCCTCCAGTGCCTCTGGGG + Intergenic
900682181 1:3923130-3923152 GGCTCCTTCCAGAGGCTCTAAGG - Intergenic
900851383 1:5145751-5145773 CAGTCCCTCCAAAGCCTCTAGGG - Intergenic
900934414 1:5756162-5756184 CGCTTCTTCCAGAGGCTCCAGGG + Intergenic
900941464 1:5801369-5801391 TGCTCCCTCCAGAGGCTCTGGGG - Intergenic
901080415 1:6580754-6580776 CACTTTTTCCAGAGCCTCTACGG + Exonic
901108517 1:6776623-6776645 CACTCCTTCCAAAGGCTCTAGGG - Intergenic
901568839 1:10142690-10142712 CATTCCCTGCAGAGGCTCTAGGG + Intronic
901937236 1:12635323-12635345 CAGTCCCTCCAGAGGTTCTAGGG - Intergenic
902347040 1:15825864-15825886 CAATTCCTCCAGAAGCCCTAAGG + Intergenic
902755064 1:18543623-18543645 TTCTTCCTCCAGGGGCTCTAGGG - Intergenic
902998885 1:20250145-20250167 CACTTCCTCTGCAGGCTCTAGGG - Intergenic
904104776 1:28069995-28070017 AACTTGCTCCAGAGGCTTTAGGG - Intronic
907335182 1:53694975-53694997 CACTACCTCCCCAGACACTAGGG + Intronic
907585649 1:55615520-55615542 TACTCCCTCCCAAGGCTCTAGGG - Intergenic
909195378 1:72614929-72614951 CACCTCTTCCTGAGGCTCTAAGG - Intergenic
909477959 1:76103661-76103683 CACTCCCTCCAAAGGCTCTAGGG + Intronic
910142280 1:84038775-84038797 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
910202484 1:84713873-84713895 TACTCCCTCCAGGGGCTCTAGGG + Intergenic
910310973 1:85824275-85824297 CGCTCCCTCTAGAGGCTCTAGGG - Intronic
910502326 1:87907059-87907081 TGCTTCCTCCAGAGGCTCTGTGG + Intergenic
910828067 1:91430148-91430170 CACTGCCTCCAGAAGCTATAAGG - Intergenic
911543719 1:99190120-99190142 CACTCCCACCAGAAGCCCTATGG - Intergenic
911838547 1:102652176-102652198 CACTCTCTCCAGAGGCTCTCGGG + Intergenic
912012622 1:104987226-104987248 TGTTCCCTCCAGAGGCTCTATGG - Intergenic
913057338 1:115174760-115174782 TGCTCCCTCCAGAGGCTCTGAGG + Intergenic
913135265 1:115882340-115882362 CACTCCTTCCAGAGTCTCTAGGG - Intergenic
913170756 1:116230012-116230034 CACTCCCTTCTGAGGCTCTTGGG + Intergenic
914254936 1:145954199-145954221 TGCTCCCTCCAGAAGCTCTAGGG - Intronic
914667854 1:149846999-149847021 CACTCCCTCCAGAGACCTTAAGG + Intronic
914967833 1:152277276-152277298 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
915254405 1:154615096-154615118 TGCTCCCTCCAGAGGCTGTAGGG - Intronic
915328659 1:155094623-155094645 AAACACCTACAGAGGCTCTATGG + Intergenic
915742704 1:158131431-158131453 GGCTCCCTCCAGAGGCTATAGGG - Intergenic
916263594 1:162868494-162868516 CACTTCCTCCAGAGGGTCTGTGG - Intronic
916358190 1:163936740-163936762 CGCTGCCTACAGAAGCTCTAGGG + Intergenic
916680743 1:167103022-167103044 CACAGCCTCCAAAGACTCTAGGG + Intronic
916846568 1:168656958-168656980 TGCTTCCTCCAGAGCCTCTAGGG + Intergenic
917058022 1:171004632-171004654 CACTTCCTTCAGAGGGTCTGTGG + Intronic
917437292 1:175034194-175034216 CGCTCCCTCCAAAGGCTCTAGGG + Intergenic
918009045 1:180569470-180569492 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
918083395 1:181224529-181224551 CACTCCCTCTGGAGGCTCTAAGG - Intergenic
918158224 1:181872021-181872043 CACTTCCTTCAGAGGGTCTTTGG - Intergenic
918901577 1:190427651-190427673 CACTCCTTCTTGAGGCTCTAAGG - Intronic
920760292 1:208777253-208777275 CTCTTCCTCCAGAGGTTCTAGGG - Intergenic
921354945 1:214277104-214277126 CACTCCCTCCCGAGGCTCTAGGG + Intergenic
921549249 1:216512990-216513012 CACTCCCTCTGGAGACTCTAGGG - Intronic
922174517 1:223186695-223186717 CACTCCCTCTAGAGACTCTAGGG - Intergenic
922372493 1:224925305-224925327 CACTGCCTGCAGAGGCTCCAAGG - Intronic
922657769 1:227401257-227401279 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
922673542 1:227533114-227533136 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
922858345 1:228794412-228794434 CACAGCCTCTAGGGGCTCTAGGG + Intergenic
923009214 1:230074898-230074920 CACTGCCTCCAGAGGCCCTGAGG - Intronic
923312393 1:232747602-232747624 CGCTCCCTCCAGAGGCTCTAGGG + Intergenic
923313022 1:232754557-232754579 GGCTCCCTCCAGAGGGTCTAAGG - Intergenic
923808803 1:237289183-237289205 CGCTTCCTTCAGAGGCTCTGTGG + Intronic
923874555 1:238034021-238034043 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
923982151 1:239337181-239337203 TGCTCCCTCCAGAGACTCTAGGG + Intergenic
924444551 1:244117000-244117022 CATTCCCTCCACAGGCTATAGGG - Intergenic
1063449485 10:6141992-6142014 CACTAACTCCACAGGCTCCGAGG + Intergenic
1063715094 10:8519258-8519280 CACTCCTTCCAGGGGCTCTAGGG - Intergenic
1063868779 10:10396111-10396133 CACTCTCTCCAGAGGTTCTAGGG - Intergenic
1063868960 10:10397712-10397734 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1064842408 10:19609153-19609175 CACTACCTACAGATTGTCTATGG - Intronic
1065004031 10:21363098-21363120 CACTCCCTTCAGAGGCTCTAGGG - Intergenic
1065267577 10:23993459-23993481 CAATACCTTCAGAAGCTCCATGG + Intronic
1066558819 10:36646267-36646289 CACACCCTTCAGAGGCTCTCGGG + Intergenic
1067099672 10:43325512-43325534 CACTTCCTCCAGAGCCTCTAGGG + Intergenic
1067218626 10:44324707-44324729 CACTCCCTCCAGTGCCTCTAGGG - Intergenic
1067234186 10:44434714-44434736 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1068525770 10:58127724-58127746 CACTCCCTCCAGAGGCTCTATGG + Intergenic
1068724326 10:60284231-60284253 CACTTCCTCTAAAGACTCTAGGG - Intronic
1069566023 10:69464135-69464157 TACTCTCTCCGGAGGCTCTAGGG - Intronic
1069604597 10:69731533-69731555 CACTACCACCACTGGCTCTGGGG - Intergenic
1069802714 10:71092072-71092094 CACAGCCTCGGGAGGCTCTAGGG - Intergenic
1070369440 10:75768034-75768056 TATTATCTCCAGAGGCTGTAGGG - Intronic
1070406955 10:76105660-76105682 CACTCCCTCCAAAGGCTCTAGGG - Intronic
1070723092 10:78770215-78770237 CAGTCCCTCCAGAGGCTCCAGGG + Intergenic
1071359404 10:84830796-84830818 CTCTGCTTCCAGAGGCTCTGTGG + Intergenic
1071404598 10:85317984-85318006 CACTCTCTCCAGAGGCTCTAGGG + Intergenic
1071876574 10:89849471-89849493 CTCTCCCTCCAGAGGTTCCAGGG - Intergenic
1071919074 10:90329171-90329193 CACCTCCTCCACAGGCTCCATGG - Intergenic
1071931012 10:90470360-90470382 CACTCACTCAGGAGGCTCTAAGG + Intergenic
1072814933 10:98498212-98498234 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1072889501 10:99309992-99310014 CACTCCCTCCAAAAGCCCTAGGG + Intergenic
1073219087 10:101854638-101854660 CCTTACCTCCAGAGGCTTCAGGG - Intronic
1073459645 10:103659279-103659301 CACTACCTCCTGCTGCTCAAGGG + Intronic
1074136026 10:110627039-110627061 CACTACCTCCAGGGACACCAAGG + Intergenic
1074311070 10:112323815-112323837 TGCTCCCTCCAGAAGCTCTAGGG - Intergenic
1074562075 10:114543815-114543837 CAATACCTGCAGAGGCTCAGAGG - Intronic
1074600362 10:114907754-114907776 CGCTCCCTCCAAAGTCTCTAAGG - Intergenic
1074608894 10:115002379-115002401 AACAACCTCAAGAGGCACTATGG - Intergenic
1074927780 10:118091434-118091456 CGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1075127398 10:119711566-119711588 TTCTCCCTTCAGAGGCTCTAAGG + Intergenic
1075245484 10:120818505-120818527 CGCTCCCTCCAGAGGCTCTAGGG - Intergenic
1075662482 10:124207713-124207735 TACGCCCTCCAGAGGCTCTAGGG + Intergenic
1076462375 10:130655985-130656007 CACTGCCTCCAGGGCCTCTCAGG + Intergenic
1076651688 10:131994015-131994037 CACTCCCTCCAGAGGCTCCAGGG + Intergenic
1077552903 11:3209652-3209674 CACTCCCTCTGGAAGCTCTAGGG + Intergenic
1078734415 11:14006988-14007010 CACTCCCTCTGGGGGCTCTAGGG + Intronic
1078928461 11:15894926-15894948 TGCTCCCTCCAAAGGCTCTAAGG + Intergenic
1079569889 11:21930014-21930036 CACTGCCTCTGGAGGCTCTAAGG + Intergenic
1079732006 11:23945056-23945078 CATTTCCTCCAAAGGCTCTAGGG + Intergenic
1079794292 11:24779983-24780005 AGCTCCCTCCAGAGGCCCTACGG - Intronic
1080048623 11:27835946-27835968 CACTCTCTCCTGAGGCTCTAAGG + Intergenic
1080153167 11:29076954-29076976 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1080185671 11:29482582-29482604 CACTTCCTCCTGAGGATATACGG + Intergenic
1080295543 11:30723164-30723186 TACTTCCTCCAATGGCTCTAGGG - Intergenic
1080324001 11:31049615-31049637 CACTTCCTTCAGAGGGTCTGCGG - Intronic
1080391858 11:31855378-31855400 CAATCCCTCCAGAGGCCTTAGGG - Intronic
1080586017 11:33683208-33683230 CACTTCCTTCAGAGCGTCTATGG + Intergenic
1082648391 11:55756613-55756635 CACTCCCTGCAGAGACTCCAGGG + Intergenic
1082665121 11:55966575-55966597 CACTTCCTTCAAAGGCTTTAAGG + Intergenic
1082903772 11:58284708-58284730 CACTTCCTTCAGAGGATCTGTGG - Intergenic
1083692005 11:64415080-64415102 CACTCCCTCCAGGGCCTCCAGGG - Intergenic
1084581971 11:70029755-70029777 CACTCCCTCTAGAGGCCCTGGGG + Intergenic
1084712597 11:70853146-70853168 CACTCTCCCCACAGGCTCTAAGG - Intronic
1084730545 11:71070523-71070545 TACTACCTCCAGAGGCTTCCTGG + Intronic
1085342295 11:75740899-75740921 ACTTCCCTCCAGAGGCTCTAGGG + Intergenic
1086082854 11:82923114-82923136 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1087021849 11:93611059-93611081 GCCTCCCTCCAGAGGCTCCAGGG + Intergenic
1087815659 11:102655630-102655652 TACTCCCTCTAGAAGCTCTAGGG + Intergenic
1087910953 11:103752836-103752858 CACTTACTGCAGAGGCTCTATGG - Intergenic
1088156835 11:106815929-106815951 TGCTATCTCCAGAGGCTCTGGGG - Intronic
1088239388 11:107758304-107758326 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1088332341 11:108666595-108666617 TGCTCCCTCCAGAGGTTCTAGGG + Intronic
1088536123 11:110863635-110863657 CACTACCTCCATAGGCTCTAGGG + Intergenic
1089047443 11:115515277-115515299 CTCAGCCTCCAGAGGCTCTATGG - Intergenic
1089202604 11:116733484-116733506 CACTACCTCATGAGGCCCTGTGG - Intergenic
1089326091 11:117658221-117658243 CATGAGCTCCAGAGACTCTAGGG - Intronic
1089869259 11:121657538-121657560 CAATACCTCCAGAGTGTTTAGGG + Intergenic
1090230911 11:125103055-125103077 TGCTCCCTCCAAAGGCTCTAGGG + Intronic
1090752902 11:129763269-129763291 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1090895139 11:130965090-130965112 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1091203711 11:133802536-133802558 CACTTTCTCTGGAGGCTCTAAGG + Intergenic
1092129306 12:6097610-6097632 AACTCCCTCCAGAAGCTCTCGGG - Intronic
1093064213 12:14639703-14639725 CACTTCCTCCAGAAGAGCTAAGG - Intronic
1093337920 12:17932264-17932286 CACTCTCTCCAGAGGTTCTTGGG - Intergenic
1093524605 12:20092321-20092343 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1093533387 12:20194353-20194375 TGCTCCCTCCAGAGGCTGTAGGG + Intergenic
1093993197 12:25613073-25613095 CACTTCCTCCAGAGCTTCCAGGG - Intronic
1094263600 12:28528507-28528529 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1094476318 12:30843406-30843428 GACAACCTCCAGATGGTCTATGG + Intergenic
1094558622 12:31528198-31528220 AACTCCCTCCAGACGGTCTAGGG + Intronic
1095399903 12:41802019-41802041 TGCTACCTCCGGAGGCTCTGGGG - Intergenic
1095508787 12:42926938-42926960 CATTCTCTCCAAAGGCTCTAGGG + Intergenic
1095569621 12:43669570-43669592 TGCTGCCTCCAGAGGCTCTAGGG - Intergenic
1095729673 12:45492989-45493011 CACTTTCTCCAGAGGCTCTAGGG + Intergenic
1096123666 12:49104760-49104782 TACTACATCCAGTGGCTCAACGG - Exonic
1096399283 12:51291776-51291798 AACCCCCTCCAGAGGCTGTAGGG + Exonic
1097534276 12:60846658-60846680 CACTAACTCTAGAGGCAATATGG - Intergenic
1097544170 12:60978151-60978173 CACTGCCCCCAGAGGCTCCAGGG + Intergenic
1097763413 12:63494917-63494939 CACTTCCCCCAGAGGCTCCTGGG + Intergenic
1097908140 12:64941769-64941791 CACAACCTCCGGAGGCTGCAGGG - Intergenic
1098549886 12:71751579-71751601 AACCCCCTCCAGAGGCTCTAGGG + Intergenic
1098965536 12:76783950-76783972 TGCTCCCTCCAGAGGCTCTAGGG - Intronic
1099004994 12:77225163-77225185 TAATTCCTCCAGAGGGTCTAGGG - Intergenic
1099794659 12:87384024-87384046 CAAAACCTCCTGAGACTCTAGGG - Intergenic
1099804890 12:87506499-87506521 CATTCTCTCCAGAGGCTCTAGGG - Intergenic
1099972753 12:89516745-89516767 CACTCTCTCCAAAGGCTCTAGGG + Intronic
1100371059 12:93969061-93969083 CACTCCCTCCAGGGGCTCTCGGG + Intergenic
1100930123 12:99598933-99598955 CGCTCCCTCCAGAGGCTCTAGGG + Intronic
1101308755 12:103556977-103556999 CACTCCCTCCAAAGGCTCTGTGG - Intergenic
1101998467 12:109541736-109541758 CACTCCCTCTGGAGGCTCTGGGG + Intergenic
1102720834 12:115014540-115014562 CACTCCCTCCGAAGGCTCCAGGG + Intergenic
1103166126 12:118772192-118772214 CGCTCCCTCCAAAGGCTCTAGGG - Intergenic
1103284055 12:119785497-119785519 CACTCTCTCTGGAGGCTCTAGGG - Intronic
1103674862 12:122647723-122647745 CACTCTCTCCAAAGTCTCTAGGG + Intergenic
1103730761 12:123026365-123026387 CACTTCCTCCAAAGGTTCTACGG - Intronic
1103840906 12:123863509-123863531 CACTCCCTCCGAAGGCTCTAGGG + Intronic
1103920065 12:124394708-124394730 CATTCCCTCCAGAGGCTCTGGGG - Intronic
1103943245 12:124512281-124512303 TACTCCCTCCAGAAGCTCAAAGG + Intronic
1104056068 12:125231072-125231094 TGCTCCCTCCGGAGGCTCTAGGG + Intronic
1104096611 12:125563907-125563929 CACTTCCTCCAACGGCTCCAGGG - Intronic
1104340686 12:127945826-127945848 CACTCCCTCTGAAGGCTCTAGGG - Intergenic
1104389496 12:128379507-128379529 CACCCACTCCAGAGGCGCTAGGG + Intronic
1104467183 12:128999994-129000016 TGCTCCCTTCAGAGGCTCTAGGG + Intergenic
1104587699 12:130060802-130060824 TGCTCCCTGCAGAGGCTCTAGGG - Intergenic
1106571834 13:30934550-30934572 CACTCCCTCTACAGGCCCTAGGG + Intronic
1107184697 13:37505119-37505141 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1107386419 13:39914588-39914610 TACTGTCTCCAGAGGCTCTGGGG - Intergenic
1107669205 13:42726431-42726453 CACAGTCTCCAGAGACTCTAGGG + Intergenic
1107803833 13:44135433-44135455 CACTACTTGCAGAGGCTCTAGGG - Intergenic
1108776269 13:53768880-53768902 AACTCCCTCCAAAGGCTTTAGGG + Intergenic
1110367918 13:74708545-74708567 CATTCCCTGCAGAGGCTCTATGG - Intergenic
1111430111 13:88138307-88138329 CTCTTCCTCTAAAGGCTCTATGG + Intergenic
1111511858 13:89276893-89276915 TACTACCCCCAGAGGCTTAAAGG + Intergenic
1112207203 13:97336645-97336667 CCCTCCCTCCAGAGGCTCTAGGG - Intronic
1112364561 13:98745668-98745690 CACTCCCTCCGAAGGCTCTGGGG - Intronic
1112366161 13:98757239-98757261 TGCTCCCTCCAGAGGCTCTGGGG + Intergenic
1112569452 13:100580473-100580495 CCCTCCCTCCAAAGGCTGTATGG - Intronic
1113084193 13:106550713-106550735 CACTTCCTCCAGAGGTTCTATGG + Intronic
1113451851 13:110415842-110415864 TACTACCTGCAGAGGCCCCATGG + Intronic
1113531883 13:111033084-111033106 CACTCCCTCCACGGGCTCCAGGG - Intergenic
1113638279 13:111937243-111937265 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1115564473 14:34613202-34613224 CTCTCCCTCCGGAGGCTCTAGGG - Intronic
1115756312 14:36528949-36528971 TACTCTCTCCAGAGGCTCTGGGG + Intergenic
1116346575 14:43802555-43802577 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1117112628 14:52474922-52474944 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1117510918 14:56449510-56449532 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1118645435 14:67834089-67834111 CATTCTCTCCAGAGGTTCTAGGG + Intronic
1119042245 14:71285555-71285577 GGCTCCCTCCAGAGGTTCTAGGG + Intergenic
1119678651 14:76575427-76575449 CACTCCCTCCAGAAGCTCTAGGG + Intergenic
1119877071 14:78069951-78069973 CCCTGCCTCCCGAGGCTCTGAGG - Intergenic
1120185606 14:81390851-81390873 CACTCCCCGCAGAGGCTTTAAGG + Intronic
1120545737 14:85809103-85809125 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1120825599 14:88952046-88952068 CACTCCCTCCAAAGTCTCTATGG - Intergenic
1121168074 14:91827357-91827379 CATTACTTCTGGAGGCTCTATGG + Intronic
1121171141 14:91855365-91855387 TGCTCCCTCCAGAGGCTCTAGGG + Intronic
1121544644 14:94754534-94754556 AGCCACCTCCAGAGGCTCCAGGG + Intergenic
1121717026 14:96083680-96083702 CACTCCTTCTGGAGGCTCTAGGG - Intronic
1121833504 14:97071959-97071981 CACTTCCTCCAAGGGCACTAGGG - Intergenic
1121913116 14:97810426-97810448 TGCTCCCTCCAGAGGCTCTTGGG + Intergenic
1121918779 14:97860892-97860914 CACTCCCTCCAAAGCCTCTAGGG - Intergenic
1122294929 14:100700077-100700099 TGCTCTCTCCAGAGGCTCTAGGG - Intergenic
1122637353 14:103136351-103136373 CACTCCTTCTGGAGGCTCTAGGG + Exonic
1124050896 15:26196856-26196878 TTCTCCCTCCAGAGGCTCCAGGG - Intergenic
1124342360 15:28898104-28898126 CATTCCCTCCAGAGGCACCAGGG - Intronic
1125269533 15:37922351-37922373 CACTTCCTTCAGAGGGTCTCAGG + Intronic
1126075052 15:44901012-44901034 AGCTCCCTCCAGAGGCTCTAGGG + Intergenic
1126083312 15:44986809-44986831 AGCTCCCTCCAGAGGCTCTAGGG - Intergenic
1126121035 15:45251848-45251870 CTCCACCTCCAGAGGCTCAAGGG + Intergenic
1126451670 15:48815235-48815257 TGCTCCCTCCAAAGGCTCTAGGG - Intergenic
1126878028 15:53065151-53065173 CGCTTCCTCCAGAGGCTCTTGGG - Intergenic
1126910727 15:53414682-53414704 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1127031010 15:54863194-54863216 CACTGCCTTCAGAGGGTCTGTGG - Intergenic
1127640296 15:60909758-60909780 CTCTCTTTCCAGAGGCTCTATGG - Intronic
1127699433 15:61483794-61483816 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1127715578 15:61645925-61645947 GGCTTCCTCCAAAGGCTCTAAGG - Intergenic
1128132400 15:65237663-65237685 TACTCCCTCTGGAGGCTCTAGGG - Intronic
1128520200 15:68370093-68370115 CACTCCCTCCGCAGGCTCTGGGG - Intronic
1128618281 15:69127430-69127452 CATTTCCTCTGGAGGCTCTAGGG - Intergenic
1128752419 15:70158980-70159002 CATTCCCTCCAGGGACTCTAGGG - Intergenic
1128820315 15:70646428-70646450 CACTTCCTCTAGAGGCTCTGGGG - Intergenic
1129335528 15:74850173-74850195 AACTCCCTTCTGAGGCTCTAAGG - Intronic
1129505566 15:76078875-76078897 CACTCCCTGCATAGGCTCTGGGG + Intronic
1129562885 15:76590059-76590081 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1130330749 15:82920457-82920479 TGCTGCCTCCAGAGGCTCTAGGG + Intronic
1130892309 15:88143383-88143405 CACTCCCTTCAAAGGCTCTGCGG - Intronic
1130912256 15:88278868-88278890 CACGACCTTCAGAGGCCCTGGGG + Intergenic
1130938109 15:88487256-88487278 TGCTTCCTTCAGAGGCTCTAGGG - Intergenic
1132414031 15:101607899-101607921 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1132609275 16:807283-807305 CGATCCCTCCAGAGGCTATAGGG - Intronic
1132675668 16:1120386-1120408 GGCTTCCTCCAGAGGCTCCAGGG + Intergenic
1133626587 16:7575596-7575618 CACTTCCTCTAGAGGCTCTAGGG - Intronic
1133852215 16:9516183-9516205 CACTTCCTCCAGGGGCTCTAGGG - Intergenic
1133854786 16:9539427-9539449 CACCCCCTCCAGAGGCTCCAAGG - Intergenic
1134475081 16:14566446-14566468 AGCTCCCTCCAGAGGCTCTGGGG - Intronic
1134597835 16:15510102-15510124 CGCGCTCTCCAGAGGCTCTAGGG - Intronic
1134805905 16:17125207-17125229 CACCTCCTTCAAAGGCTCTATGG + Intronic
1135527023 16:23221382-23221404 TGCTCCCTCCAGAGGCTCTAGGG + Intergenic
1136586597 16:31190285-31190307 CACCACCTCCATAGCCTCCACGG - Exonic
1136702378 16:32156135-32156157 TGCTCCCTCCACAGGCTCTAGGG - Intergenic
1136765289 16:32771353-32771375 TGCTCCCTCCACAGGCTCTAGGG + Intergenic
1136802810 16:33099031-33099053 TGCTCCCTCCACAGGCTCTAGGG - Intergenic
1137777814 16:51071177-51071199 CACTCCCTGCGGGGGCTCTAAGG - Intergenic
1137801413 16:51265546-51265568 TAGTCCCTCCAGAGGCTCTAGGG + Intergenic
1138402892 16:56762766-56762788 CACACTCTCCATAGGCTCTAGGG + Intronic
1140871944 16:79114574-79114596 CGCTCCCTCCGAAGGCTCTAGGG - Intronic
1141268670 16:82519790-82519812 CACTCCCTCGGGAGGCTCTGGGG - Intergenic
1141311852 16:82921265-82921287 CACTCTCTCCAGAAGCTCTCGGG + Intronic
1141314521 16:82949200-82949222 CACTACTTTCAGAGTGTCTAGGG + Intronic
1141639220 16:85331939-85331961 CCCTTCCTCCAGAGGCCCCAAGG - Intergenic
1141656642 16:85420278-85420300 CACTCCCTCCAGAGGTACTAGGG - Intergenic
1141762172 16:86035836-86035858 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1141763678 16:86045098-86045120 CAATCCCTCCAGAGGCTCTAGGG - Intergenic
1141773892 16:86109502-86109524 TACTCCCTCCAGAGGCTGTAGGG - Intergenic
1141897897 16:86970360-86970382 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1203067677 16_KI270728v1_random:1033586-1033608 TGCTCCCTCCACAGGCTCTAGGG + Intergenic
1144095604 17:11897941-11897963 TGCTCCCTCCAGAGGCTCTAGGG + Intronic
1144335681 17:14267147-14267169 AGTTTCCTCCAGAGGCTCTAGGG + Intergenic
1144583064 17:16470879-16470901 CACTCCCTCTAGAGATTCTAGGG + Intronic
1144592228 17:16534363-16534385 TGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1144752256 17:17657235-17657257 CATTCCCTCCAGAGGCTCTAGGG + Intergenic
1146060391 17:29602470-29602492 CAGTCCTTCCAAAGGCTCTAGGG + Intronic
1146503924 17:33388250-33388272 TACCCCCTCCAGAGGCTCTGGGG - Intronic
1146583272 17:34059113-34059135 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1146606173 17:34259625-34259647 CATTCCTTCCAGAGGTTCTATGG + Intergenic
1146835518 17:36107699-36107721 CACTCCCTTTGGAGGCTCTAGGG - Intergenic
1146850147 17:36214970-36214992 CACTCCCTTTGGAGGCTCTAGGG - Intronic
1147890845 17:43715729-43715751 CACTTCCTGCAGAGGATCTGTGG + Intergenic
1148893925 17:50829014-50829036 CGCTCCCTCCAGAGGCTTTAGGG + Intergenic
1149122388 17:53185112-53185134 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1149420530 17:56506504-56506526 CACTCCCTCTGGAGGTTCTAGGG - Intronic
1149516257 17:57283243-57283265 CACTCACTCCAGAGACTTTACGG - Intronic
1150345563 17:64402225-64402247 CACTCCCTGCAGAGGCTCTGCGG + Intronic
1151874480 17:76859090-76859112 CGTTCCTTCCAGAGGCTCTAGGG + Intergenic
1151903345 17:77032321-77032343 CACTCTCTGCGGAGGCTCTAGGG - Intergenic
1151945576 17:77318202-77318224 CACAGCCACCAGAGGCTCAAAGG - Intronic
1151999217 17:77634872-77634894 CACTCCCTCTCGAGGCTCTAGGG + Intergenic
1152242522 17:79167885-79167907 CAGAACCTCCAAAGGCTCTATGG + Intronic
1152372909 17:79901613-79901635 GCGTCCCTCCAGAGGCTCTAGGG + Intergenic
1152900219 17:82936910-82936932 CACTCCCTCCAGAGGCTACCTGG - Intronic
1153655857 18:7281605-7281627 CTCAACCTTCAGAGGTTCTAGGG + Intergenic
1153685935 18:7545402-7545424 CGCTCCCTCCAGGGGCTCTAGGG + Intergenic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1155259972 18:24032123-24032145 CACTCCCTGGGGAGGCTCTAGGG - Intronic
1157210523 18:45738226-45738248 CACTGCCTCCAGAAGGTCTTTGG + Intronic
1157540833 18:48505408-48505430 CACTTCCTTCAGAGGATCTGTGG - Intergenic
1159454169 18:68639287-68639309 CACTTCCTTCAAAGGGTCTATGG + Intergenic
1159665184 18:71149825-71149847 CACTCCCTCCAGGGGCTCAAGGG - Intergenic
1160115337 18:76074021-76074043 CGCTCCCTCCGGAGGCTCAAGGG + Intergenic
1160267734 18:77354428-77354450 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1160701472 19:509521-509543 CACTCCCTCTGGAGGCTCCAGGG + Intronic
1160729967 19:637186-637208 CGCTCCCTCCAGAGGCCCTGGGG + Intergenic
1161098140 19:2405632-2405654 AATTACTTCCAGGGGCTCTAAGG - Intronic
1161478278 19:4498212-4498234 CAAATCCTCCAGAGGCTCTCAGG + Intronic
1161654171 19:5503482-5503504 TGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1162987988 19:14284074-14284096 CGCTCCCCACAGAGGCTCTAGGG + Intergenic
1163343839 19:16727370-16727392 CACCACCTCCAGTGCCTCTGGGG - Intronic
1163400301 19:17088122-17088144 CACTCCCTCTGGAGGCTCTACGG + Intronic
1163413171 19:17169631-17169653 TGCTGCCTCCAGAGGCTCCAAGG + Intronic
1163682563 19:18691674-18691696 TGCTTCCTCCAGAGGCTCTAGGG - Intronic
1163724869 19:18917033-18917055 CACTCCTTCCAAAGGCTCTAGGG + Intronic
1163755268 19:19102922-19102944 CGTTCCCTCCAGAGGCTCTAGGG + Intronic
1165155584 19:33785229-33785251 CATTCCCTCTAGAGGCTCCAGGG - Intergenic
1165170297 19:33887575-33887597 CTCTGCCTCCAGAGGCTCAGGGG - Intergenic
1166604392 19:44127415-44127437 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1167085541 19:47307262-47307284 CACTCCCTCCAGAGGTTCCAGGG - Intronic
1167355804 19:49003318-49003340 CTCTACCTGCCGAGGCTCCAAGG - Exonic
1167538309 19:50069461-50069483 CGCTGCCTCCAAAGGCTCCAGGG - Intergenic
1167548803 19:50145329-50145351 TGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1168345737 19:55649402-55649424 CGCAGCCTCCGGAGGCTCTAGGG - Exonic
1168634129 19:57982166-57982188 TGCTCCCTCCAGAAGCTCTAAGG + Intronic
925069872 2:957805-957827 AAATTCCTCCAGAGGCTCCAGGG - Intronic
925072592 2:982942-982964 CACTACCTCCGCAGCTTCTATGG - Intronic
926349930 2:11985170-11985192 TGCTCCCTCCAGAGGTTCTAGGG + Intergenic
926502081 2:13668186-13668208 CACTTCCTCCAAAGGCTCTAGGG - Intergenic
926599084 2:14822137-14822159 CACTACCTACACAGGTTCTTTGG - Intergenic
926764661 2:16313769-16313791 GGCTCCCTCCAGAGGCTCTAGGG + Intergenic
927233861 2:20851900-20851922 CGTTCCCTCCAAAGGCTCTAGGG + Intergenic
927609646 2:24525042-24525064 CACTACCCTCAGATTCTCTAAGG - Intronic
927763096 2:25778410-25778432 CACTCCCTACAGAGGCTCTGGGG - Intronic
928138472 2:28706952-28706974 CACTCCCCCCAGAGGCTCTGGGG - Intergenic
928443367 2:31311931-31311953 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
928783221 2:34849879-34849901 CAGTTCCTCCAAAGACTCTAGGG - Intergenic
929029547 2:37637680-37637702 TACTCCCTCCAGAGGCTCTAGGG + Intergenic
929180320 2:39031028-39031050 CACTTTCTCTAAAGGCTCTAAGG - Intronic
929335866 2:40744958-40744980 GGCTCCCTCCAGAGGCTCTATGG - Intergenic
930040833 2:47121718-47121740 TGCTCCCTCCAGAGGATCTAAGG + Intronic
931122513 2:59235641-59235663 CACTCCATCCAAAGACTCTAGGG + Intergenic
931782189 2:65588418-65588440 CATTTTTTCCAGAGGCTCTATGG + Intergenic
931834545 2:66085313-66085335 CACTTCCTCCAAAGGTTCTGTGG - Intergenic
932270238 2:70403076-70403098 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
932385035 2:71324060-71324082 CACTTCCTTCAGAGGATCTGTGG + Intronic
932438960 2:71719746-71719768 CCCTGCCTCCAGGGGCTCTGGGG - Intergenic
933190509 2:79328850-79328872 AGCTCCCTCCAGAGGCTCAAGGG + Intronic
933531387 2:83517043-83517065 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
934057445 2:88263605-88263627 CACTCCCTCCAAAGTCTCAATGG + Intergenic
935586490 2:104804329-104804351 TGCTCCCTCCAGAGGCTCTAGGG + Intergenic
936405292 2:112197437-112197459 CACTTCCTCCAAAGGCTGCAGGG - Intergenic
936958436 2:118047426-118047448 CACTACAGACAGAGACTCTAGGG - Intergenic
937057720 2:118953674-118953696 CACTTCCTTCAGAGGGTCTGTGG - Intronic
937319633 2:120953371-120953393 CACTCCCTCCAGAGGCTCAAGGG - Intronic
937529039 2:122806677-122806699 CACTCTCTCCGAAGGCTCTAGGG + Intergenic
937767765 2:125680875-125680897 CACTTCCTTTAGAGGTTCTAGGG + Intergenic
938038295 2:128054418-128054440 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
938738337 2:134206837-134206859 TGCTCCCTCCAGAGGCTCTAGGG - Intronic
938960239 2:136334313-136334335 TGTTCCCTCCAGAGGCTCTAGGG + Intergenic
940073458 2:149715384-149715406 TGCTCCCTCCAGAGGCTCCAAGG + Intergenic
940250091 2:151665465-151665487 CTCCACCTCCAGGGACTCTATGG + Exonic
940806605 2:158194556-158194578 CCCTACCTCCAGAGAGCCTAGGG - Intronic
940882119 2:158957187-158957209 TCCTCCCTCCAGAGGCTCTGGGG - Intergenic
943479485 2:188400108-188400130 CTGTCCCTCCAAAGGCTCTAGGG + Intronic
943848595 2:192686730-192686752 CACTTTCTCCAGAGGCTTTAGGG + Intergenic
944135217 2:196391793-196391815 TCCTCCCTCCAAAGGCTCTAGGG + Intronic
944601989 2:201312822-201312844 CACTTCCTTCAGAGGGTCTGTGG - Intronic
944618329 2:201485068-201485090 CACTCCTTCCGGAGTCTCTAGGG + Intergenic
945060884 2:205907809-205907831 TACTCCCTCCAAAGGCTCTGGGG + Intergenic
945579359 2:211573261-211573283 CATTCCCTCCAGAAGCTCTAGGG - Intronic
945743351 2:213690382-213690404 CACTGCCTCCAGAGGCAGAAGGG + Intronic
945792803 2:214326343-214326365 TGCTCCCTTCAGAGGCTCTAGGG - Intronic
947270203 2:228326448-228326470 CACTTCCTTCAGAGGGTCCATGG - Intergenic
947675522 2:231975824-231975846 CATTACCTCCAGGGCCTCTAAGG - Intronic
947861382 2:233360904-233360926 CACTCCCTCTAAAGGCTCTAGGG - Intronic
947979031 2:234393140-234393162 CACTCCCTCTGGAGGCTTTAGGG + Intergenic
948015469 2:234686698-234686720 CACCGTCTCCAGAGGCTCTGGGG - Intergenic
948075205 2:235160550-235160572 CTCTCCCTCCGGAGGCTCTTGGG + Intergenic
948265901 2:236635170-236635192 TGCTCCCTCCAGGGGCTCTAGGG - Intergenic
948525902 2:238570613-238570635 TGCTCCCTCCAGAGGCTCTAAGG - Intergenic
948527715 2:238582392-238582414 CATTCCTTCCAGAGGCTTTAGGG + Intergenic
948713874 2:239846562-239846584 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
948759388 2:240181201-240181223 TGCTCCCTCCAGCGGCTCTAGGG + Intergenic
948845237 2:240679963-240679985 CTCTGCCTCCTGAGGCTTTAGGG + Intronic
948848623 2:240694916-240694938 CTCTGCCTCCTGAGGCTTTAGGG - Intronic
1168914323 20:1473952-1473974 CACTTCCTCCGGAGGCTCCAGGG + Intronic
1169775306 20:9245646-9245668 TACTCCCTACAGAGGTTCTAGGG - Intronic
1169886080 20:10399187-10399209 TGCTCCCTCCGGAGGCTCTAGGG - Intergenic
1170210130 20:13839624-13839646 CACTCCCTTCAGAGGCTCTAAGG + Intergenic
1170863849 20:20135213-20135235 TGCTCACTCCAGAGGCTCTAGGG - Intronic
1170879280 20:20280333-20280355 TGCTCCCTCCAGAGGCTCTAGGG - Intronic
1172465019 20:35149741-35149763 CACCCACTCCAAAGGCTCTAAGG + Intergenic
1173000752 20:39103865-39103887 CACTCCCTCTGGAGGCTGTAGGG + Intergenic
1173858548 20:46267238-46267260 CACCTGCTCCAGAGGCTCTCAGG - Intronic
1174098251 20:48106673-48106695 CATTCCTTCCAGAGGCTCTAAGG - Intergenic
1174532453 20:51224853-51224875 CACTCCCTCCAAAGACTCCAGGG - Intergenic
1175229319 20:57463600-57463622 CACTCCCTCCAGAGGCTATAGGG - Intergenic
1175604073 20:60298283-60298305 CACTCACTCCTGAGGCTCTGGGG + Intergenic
1175630770 20:60534629-60534651 CACTCCTACCAGAGGCTCTAAGG - Intergenic
1175699684 20:61127906-61127928 CGCTCCCTCCGTAGGCTCTAGGG - Intergenic
1175848032 20:62069222-62069244 CACTCCCTCTAGAGGCTCTAGGG + Intergenic
1176255120 20:64147729-64147751 CACTCCCTCCTGTGCCTCTAGGG - Intergenic
1176513583 21:7766922-7766944 CACTCTCTCCAGAGGCTCCAGGG - Intronic
1176524832 21:7858166-7858188 CACTGGCTCCAGAAGCTCTGAGG + Intergenic
1177017256 21:15807544-15807566 CACTTCCTCCATTGGCTCTGAGG + Intronic
1177254614 21:18644978-18645000 CACTCCCACTGGAGGCTCTAGGG + Intergenic
1177587461 21:23117139-23117161 CATTACCTTTGGAGGCTCTAGGG - Intergenic
1178009931 21:28273060-28273082 TACTTCCTCCAGAGGATCAAAGG + Intergenic
1178223066 21:30683298-30683320 CATTCCCTCCAGAGGATCTAGGG + Intergenic
1178311961 21:31536982-31537004 CACTCCCTCAAGAGACTCTGGGG + Intronic
1178357348 21:31920040-31920062 CGCTCCCTCCAGAGACTCTAGGG + Intronic
1178380576 21:32104233-32104255 CACTCCCTCAGGAGGCTCTAAGG - Intergenic
1178529039 21:33359463-33359485 CTCTATCTCCACAGGCTCTGGGG - Exonic
1178630188 21:34252739-34252761 CGCTCCCTGCAGAGGCTCTAGGG - Intergenic
1178647696 21:34397446-34397468 CACTCTCTCCAGAGGCTCCAGGG - Intronic
1178658852 21:34488179-34488201 CACTGGCTCCAGAAGCTCTGAGG + Intergenic
1178801549 21:35800679-35800701 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1178933365 21:36838865-36838887 CACTCCCTCTGGAGGCTCCAGGG - Intronic
1179565811 21:42247924-42247946 CACTCCCTCCGGAGGCTCCAGGG - Intronic
1179879914 21:44289180-44289202 CACTCCCTCTGGAGGCTCCAGGG + Intronic
1180953724 22:19731977-19731999 CACTACCTCCACAGGCTGAAGGG + Intergenic
1181769951 22:25118176-25118198 GCCTCCCTCCAGAGGCTCTAGGG + Intronic
1182768510 22:32776183-32776205 TGCTCCCTCTAGAGGCTCTAGGG - Intronic
1183048592 22:35241804-35241826 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1184472803 22:44705188-44705210 CGCTCCCACCAGAGGCTCTAGGG + Intronic
1184486651 22:44783770-44783792 CTGTACCTCCGGAGGCTCCAGGG + Intronic
1184498929 22:44860338-44860360 TGCTCCTTCCAGAGGCTCTAGGG + Intronic
1184521070 22:44994464-44994486 CACTCCCTCCGGAGGCTCGAGGG - Intronic
1184544090 22:45153994-45154016 CGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1184559223 22:45252039-45252061 TGCTGCCTCCAGAGGCTCCAGGG + Intergenic
1185125632 22:49009186-49009208 CACTCCCTGCAGGGGCTCTAGGG + Intergenic
1185188706 22:49418928-49418950 CACTCCTTCTGGAGGCTCTAGGG + Intronic
1203241999 22_KI270733v1_random:28118-28140 CACCACCTCCAGAGCCACCAGGG + Intergenic
949720042 3:6978304-6978326 CACTCCCTCCAGAATCTCTAAGG - Intronic
949773332 3:7602877-7602899 CACTATTTCCAGAGGCTTTCTGG + Intronic
949849236 3:8405308-8405330 CACTCCCTCCAGAGGTTCAAGGG - Intergenic
949901079 3:8815197-8815219 GCCTCCCTCCAGAGGCTCCAGGG - Intronic
949907085 3:8866657-8866679 CATTCCCTCTGGAGGCTCTAGGG - Intronic
949939017 3:9139546-9139568 CACTCCCTCCAGCGGCTCTAGGG - Intronic
950603683 3:14058504-14058526 CACTTCCTCCAGAGGGTCTGTGG + Intronic
951534857 3:23731259-23731281 CACTCCCTCCAAAGGCTCTAAGG + Intergenic
951621139 3:24603261-24603283 CACTCCCTCCAGAGTTTCCAGGG - Intergenic
953018814 3:39100969-39100991 CACCACATCCAGAGGGTCTGGGG + Intronic
953453488 3:43023297-43023319 TGCTACCTCCAAAGGCTCTAGGG - Intronic
955124652 3:56099210-56099232 CACACCCCACAGAGGCTCTAAGG - Intronic
955813884 3:62821429-62821451 AGCTTCCTCCAAAGGCTCTAGGG + Intronic
956312113 3:67892748-67892770 CACTCCCTCTAAAGGCTCTGGGG - Intergenic
956455606 3:69417827-69417849 TACTTCCTCCAGAGGTTGTAGGG + Intronic
956950131 3:74273418-74273440 CACTTCCTTCAGAGGGTCTGTGG - Intronic
957132061 3:76235416-76235438 CACTCCCTCCAAAGGCTTTAGGG - Intronic
957424853 3:80024326-80024348 CGCTCACTCCAAAGGCTCTAGGG - Intergenic
957637836 3:82809672-82809694 CATTCCTTCCTGAGGCTCTAGGG - Intergenic
959231566 3:103660241-103660263 CACACCCTACAAAGGCTCTAGGG - Intergenic
959275358 3:104270352-104270374 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
959583141 3:108002340-108002362 CATTCCCTCCAGAGGCTCTCGGG + Intergenic
959630395 3:108500963-108500985 CACTCCCTCTGGAGGCTCTTGGG - Intronic
959802639 3:110513040-110513062 CACTTCCTTCAGAGGATCTGTGG + Intergenic
959888884 3:111532179-111532201 TGCTTCCTCCAAAGGCTCTAGGG - Intronic
959967572 3:112374141-112374163 CATTCCATCCAAAGGCTCTAGGG - Intergenic
959976064 3:112461310-112461332 CACTATCTCCACAGTCTCCAGGG - Intergenic
959997135 3:112692736-112692758 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
960167277 3:114417533-114417555 TACTTCCTACAGAGGCTCAAAGG + Intronic
960513042 3:118572686-118572708 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
961317375 3:126049830-126049852 CACTCCCTCTGGAAGCTCTAGGG + Intronic
962040982 3:131707236-131707258 CACTCTCTCCAGAGGCTTTAGGG + Intronic
962877258 3:139544701-139544723 CATTCCCTCTGGAGGCTCTAGGG + Intergenic
963006784 3:140733941-140733963 TACTCCCTTCAGAGACTCTAGGG + Intergenic
963348666 3:144126436-144126458 TGCTCCCTTCAGAGGCTCTAGGG + Intergenic
964163569 3:153674289-153674311 CACTCCTTCTTGAGGCTCTAGGG + Intergenic
964194167 3:154043230-154043252 GCCTCCCTCCAGAGGCTCTATGG + Intergenic
964304509 3:155326090-155326112 CACTCCCTCCTCATGCTCTATGG - Intergenic
964875056 3:161357834-161357856 TACTTCCTCCAAGGGCTCTAGGG - Intronic
965862555 3:173164567-173164589 AACTGCATCCAGAGGCTCTATGG - Intergenic
967514753 3:190353981-190354003 CACTTTCTCTAGAGGGTCTAAGG + Intronic
967727110 3:192872254-192872276 CACTAGCTCCCTAGGGTCTAAGG + Intronic
967754891 3:193157441-193157463 CTCTACCTCGAGAGGTTCTAAGG - Intergenic
968047053 3:195630381-195630403 TGCTCCCTCCAGAGGCTCCAGGG + Intergenic
968076827 3:195820594-195820616 CACTCCCTCCGGAGGTTCTGGGG + Intergenic
968234700 3:197024674-197024696 CTCTACCTCAAGAGGCTAGAGGG - Intronic
968307596 3:197659663-197659685 TGCTCCCTCCAGAGGCTCCAGGG - Intergenic
968472284 4:787660-787682 CACTCCCTCTGGAGGCTCTGGGG - Intronic
968482989 4:845014-845036 CACTACCTCCAGGAGCTCTGAGG - Intergenic
969072088 4:4547649-4547671 CGCTCCCTTCAGAGACTCTAGGG - Intergenic
969078958 4:4603390-4603412 CACTCCCTCCAGAGGCTCCGGGG - Intergenic
969256000 4:6002311-6002333 TGCTTCCTCCTGAGGCTCTAGGG - Intergenic
970017629 4:11530615-11530637 CACTCCCTCCGGAGGCTCTAGGG + Intergenic
971345326 4:25806653-25806675 CACCACCTCCACCAGCTCTAAGG + Intronic
971478333 4:27092482-27092504 CACTGGCTCCACAGGCCCTACGG - Intergenic
971484216 4:27142999-27143021 CACTCCTTCCAAAGGCCCTAAGG + Intergenic
972279300 4:37587043-37587065 CACTCTTTCCAGAGGCTCCAGGG + Intronic
972432761 4:38999691-38999713 TACTACCTCTGGAGGTTCTAGGG + Intronic
972940458 4:44188828-44188850 CACTATCTCGAGAAGTTCTAGGG - Intronic
973004559 4:44991449-44991471 AAGTACCTCCAGAGGCTCAGTGG + Intergenic
973611343 4:52638369-52638391 TACACCTTCCAGAGGCTCTAGGG - Intronic
973631347 4:52823859-52823881 CACTCCCTCCAAAGCCTCTAGGG + Intergenic
973764761 4:54153004-54153026 CACTCTCTCCAAAGGCTCTAGGG - Intronic
973849721 4:54948990-54949012 CATTTCCTCCAAAGGCTCTAGGG + Intergenic
973956610 4:56069121-56069143 CAGTTCCTCCAAAGGCTCTAAGG - Intergenic
974770581 4:66406335-66406357 CACTTCCTCTAGAGGTTCTAGGG + Intergenic
975699036 4:77044096-77044118 CCTTAACTCCAGAGGCTCTTAGG + Intergenic
976113834 4:81705701-81705723 CTCTCCCTCCAGAGGCTCTGGGG + Intronic
976362874 4:84201038-84201060 CTTTATCTCCAGAAGCTCTAGGG + Intergenic
977020133 4:91747620-91747642 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
977666275 4:99650079-99650101 CAGTAGCTCCAAAGGCTCTCAGG - Exonic
977852619 4:101848238-101848260 CGCTTCCTCCAGAGGGTCTGTGG + Intronic
977917687 4:102612372-102612394 CAGTCCCTCCAGAGTGTCTATGG + Intronic
979847594 4:125535655-125535677 CACTCACTACCGAGGCTCTAGGG - Intergenic
980173768 4:129320868-129320890 CTCTACCTCCCGGGGCTCAAGGG + Intergenic
980501176 4:133656144-133656166 CACTCCCCCCAAAGGATCTAAGG + Intergenic
980848580 4:138353918-138353940 CACTCCTTCTGGAGGCTCTAGGG + Intergenic
981376667 4:144024440-144024462 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
981387170 4:144145786-144145808 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
981541503 4:145851130-145851152 CACTCCTTCCAGAGGCTCTAGGG - Intronic
982217107 4:153091987-153092009 CGCTCCCTCCAGAGTCACTAAGG + Intergenic
982438235 4:155401961-155401983 CACTCCTTCTAGAGGCTTTAGGG - Intergenic
983781674 4:171676604-171676626 CAGAACCTCCTGAGGCTGTAGGG - Intergenic
983886197 4:172983247-172983269 TGCTTCCTCCAGAAGCTCTAGGG - Intronic
985040654 4:185888456-185888478 CACTCCCTCTGGAGGCCCTAGGG - Intronic
985092729 4:186381247-186381269 CACTTCCTTCAGAGGGTCTGCGG - Intergenic
985217926 4:187672600-187672622 CACTTCCTTCAGAGGGTCTGCGG + Intergenic
985240944 4:187930111-187930133 CACTTCCCTCAGAGGGTCTATGG + Intergenic
985744562 5:1638760-1638782 TGCTCCCTCCAGAGGCTCCAGGG - Intergenic
985801946 5:2010300-2010322 CCCTACCTCCAGAGGTGCTCAGG - Intergenic
985820367 5:2156048-2156070 CACTCCCTCCAGCGGCTCCAGGG + Intergenic
985971280 5:3380644-3380666 CTCTCCCTCCAGGGGCTCCAGGG - Intergenic
986139185 5:5013715-5013737 TGCTCCCTCCAGAGGCTCTGGGG - Intergenic
986348322 5:6854602-6854624 CATTCCCTCCAAAGGCTCTAGGG - Intergenic
986375214 5:7124296-7124318 CATTCCCTCTAGAGGCTCTAGGG + Intergenic
986671143 5:10144114-10144136 TACTTCCTCCAAAAGCTCTAAGG + Intergenic
986961651 5:13220131-13220153 CATTTCCTCCACGGGCTCTAGGG - Intergenic
987371132 5:17194008-17194030 CACTGCCTCTAGAGGCTCTAGGG - Intronic
987667795 5:20967110-20967132 CACTCCCTCCAGATGATCTAGGG + Intergenic
988713410 5:33801123-33801145 CACTCCCTCTGGAGACTCTATGG - Intronic
988955389 5:36311202-36311224 TGCTCCCTCCATAGGCTCTAGGG - Intergenic
990232215 5:53725696-53725718 CATTTCCTCCAGAGGCCCTAGGG + Intergenic
990590536 5:57258363-57258385 CACTACCTACCTAGGCTATATGG + Intronic
992093562 5:73340121-73340143 GGCTACCTCTGGAGGCTCTAGGG + Intergenic
992464219 5:76987889-76987911 CACTCCCTCCAAAGGCTCCAGGG - Intergenic
992591799 5:78303352-78303374 CCCTCCCTCCAGAAGCTCTAGGG + Intergenic
993081860 5:83310949-83310971 CACTCCCTCCGGAGGCTCGAAGG - Intronic
994453249 5:99971041-99971063 CACTTCCTCCAAAGGCTGTAGGG - Intergenic
994871122 5:105351349-105351371 CACTTCCTTCAAAGGGTCTATGG + Intergenic
995772749 5:115690116-115690138 CACTGCCTCCAGACTCTGTAGGG - Intergenic
996010622 5:118478457-118478479 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
996019845 5:118579006-118579028 CACACCCTCGAGAGGCTCTAGGG + Intergenic
996128398 5:119752649-119752671 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
996933346 5:128917848-128917870 CACTCCCCACAGAGACTCTAGGG + Intronic
997348870 5:133215713-133215735 CACTCCTTCTAGAGGTTCTAGGG + Intronic
997760788 5:136445860-136445882 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
997980097 5:138463719-138463741 CCCGACCTCCAGAGGCTGTTGGG + Intergenic
998291560 5:140920081-140920103 CACTCCCTTTAGAGGCTCTACGG - Intronic
999676968 5:154014413-154014435 CACTTCCTTCAGAGGGTATATGG - Intronic
999840602 5:155421834-155421856 CACTTCCTCTAGAGGCTCCTGGG + Intergenic
999889115 5:155957507-155957529 CATTTCTTTCAGAGGCTCTAGGG + Intronic
999966581 5:156816666-156816688 TGCTACCTCATGAGGCTCTAGGG - Intergenic
1000779522 5:165464313-165464335 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1000866667 5:166522755-166522777 CTCTACCTGCAGAGACTCTGAGG + Intergenic
1001283071 5:170401969-170401991 TGCTCCCTCCAAAGGCTCTAAGG + Intronic
1001290739 5:170457409-170457431 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1001472680 5:172025987-172026009 CACTCTGTCCAGAAGCTCTAGGG + Intergenic
1001633204 5:173191935-173191957 GGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1002441995 5:179269201-179269223 TGCTCCCTCCAGAGGCTCCAGGG - Intronic
1002449902 5:179312779-179312801 CGCTCCCTCCGGAGCCTCTAGGG - Intronic
1002458775 5:179362069-179362091 CACTCCCTCCAGAGGCTTTGGGG + Intergenic
1003029579 6:2589970-2589992 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1003476742 6:6490614-6490636 CGCTTCCTCCAGTGGCTCCAGGG - Intergenic
1003671970 6:8167857-8167879 TACTCCCTCCACAGGCTCTAGGG + Intergenic
1003712056 6:8603081-8603103 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1004487828 6:16084167-16084189 CGCTCCATCCAGAGGCTCTAAGG + Intergenic
1004911385 6:20288440-20288462 TGCTATCTCCGGAGGCTCTAGGG + Intergenic
1005072369 6:21873940-21873962 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1005105349 6:22218669-22218691 CCTTCCTTCCAGAGGCTCTAGGG - Intergenic
1005708116 6:28477276-28477298 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1006095363 6:31652809-31652831 CACTGCCTCGAGAGGGGCTATGG + Intronic
1006271429 6:32969506-32969528 TGCTCCCTCCAGAGGCTCTGGGG - Intronic
1006620164 6:35358311-35358333 CACTTCCTCCAGAGGTTCTAAGG - Intronic
1006716931 6:36126372-36126394 CTCTGCCTCCAGAGGCTCACAGG + Intergenic
1007365271 6:41387216-41387238 TACTCCCTCCAAAGGCCCTAGGG + Intergenic
1007653677 6:43439016-43439038 CCCTAGCTCCAGAGGCCTTAGGG - Intronic
1008668035 6:53736283-53736305 CATTAATTGCAGAGGCTCTATGG - Intergenic
1009453030 6:63824507-63824529 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1009493729 6:64325141-64325163 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1010165244 6:72906776-72906798 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1010710954 6:79173613-79173635 CACTCCCTTTAAAGGCTCTAGGG - Intergenic
1010819019 6:80391555-80391577 CATTTCCTCTAGAGGCTCTAGGG - Intergenic
1011163408 6:84418746-84418768 CACTCCCTCCAGAGGCTCTCAGG + Intergenic
1011248925 6:85349790-85349812 CACTCCCTCGGAAGGCTCTAGGG + Intergenic
1011379371 6:86725953-86725975 CACTTCCTCCAGAGGTTCTTGGG + Intergenic
1011652085 6:89515997-89516019 TACTCCCTTCAGAGGCTCTAGGG - Intronic
1011717575 6:90123315-90123337 CACTTCCTCCAAAGGCTTCAGGG - Intronic
1011833602 6:91403804-91403826 CACTTCCTTCAGAGGGTCTATGG - Intergenic
1012205832 6:96459190-96459212 CACTCCCTCCAAAAGCTCTAGGG - Intergenic
1012302489 6:97606603-97606625 CACTCCCTTCAAAGGCTCTAGGG + Intergenic
1012425903 6:99114189-99114211 CACTGTCTGCAGAGGCTCTAAGG + Intergenic
1012793612 6:103733655-103733677 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1012806746 6:103904008-103904030 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1013430099 6:110047908-110047930 CTCTACCTCAGGAGGCTCTTCGG + Intergenic
1013480044 6:110545187-110545209 TGCTTCCTCCAAAGGCTCTAGGG + Intergenic
1013901122 6:115156884-115156906 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1014563517 6:122919264-122919286 TACTGCTTCCAGAGGCTCTAGGG - Intergenic
1014738636 6:125123719-125123741 CACTTCCTTCAGAGGGTCTGCGG - Intronic
1015118884 6:129679892-129679914 CACTCCCTCCGAAGCCTCTAGGG + Intronic
1015849936 6:137560857-137560879 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1015953916 6:138581034-138581056 CATTCCCTCCAGAGTTTCTAGGG - Intronic
1016053449 6:139554095-139554117 CACGCCCTCCAAAGGCTTTAGGG - Intergenic
1016290145 6:142519304-142519326 CACTTCCTTCAGAGGATCTGTGG + Intergenic
1016384827 6:143520366-143520388 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1016575090 6:145561270-145561292 CACTACATACCTAGGCTCTATGG - Intronic
1016743843 6:147557435-147557457 TGCTGCCTCCAGAGCCTCTAGGG + Intronic
1018131499 6:160736188-160736210 CCCTACCTCCAGAGACCCTGTGG + Intronic
1018417969 6:163617729-163617751 CACTTCCTCCAAAGGCTCTGGGG - Intergenic
1018486083 6:164242365-164242387 CACTCCCTCCAAAGTCTCCAGGG - Intergenic
1018604813 6:165585633-165585655 CACACCCTCCAGAGGCTCGAAGG - Intronic
1018730274 6:166645003-166645025 CACTCCCTCTAAAGGCTGTAGGG - Intronic
1018830458 6:167438578-167438600 CACTCCCCCCAGAGACTCTAGGG + Intergenic
1018830587 6:167439858-167439880 CACTCCCTCCAAAGGCTCTGGGG - Intergenic
1018836789 6:167491222-167491244 CGTTCCTTCCAGAGGCTCTAGGG + Intergenic
1019064751 6:169287849-169287871 TGCTCCCTCCAGAGGCTCCATGG + Intergenic
1019064761 6:169287880-169287902 TGCTCCCTCCAGAGGCTCCAAGG + Intergenic
1019064770 6:169287909-169287931 TGCTCCCTCCAGAGGCTCCATGG + Intergenic
1019064792 6:169287999-169288021 CGCTCCCTCCAGAGACTCCATGG + Intergenic
1019841822 7:3453635-3453657 CTCTCCCTCTGGAGGCTCTAAGG - Intronic
1021774993 7:24044811-24044833 CACTCCCTCCAGTAGCTCTCAGG - Intergenic
1021816107 7:24449128-24449150 TGCTCCCTCCAGATGCTCTAAGG + Intergenic
1021891149 7:25187582-25187604 CACTTCCTACAAAGGGTCTAGGG + Intergenic
1022809896 7:33858512-33858534 CATCCCCTCCGGAGGCTCTAGGG - Intergenic
1023186884 7:37541585-37541607 CACTCCCTCCTAATGCTCTAGGG + Intergenic
1023303013 7:38793700-38793722 TACTTCCTCTGGAGGCTCTAGGG + Intronic
1024037683 7:45522733-45522755 TGCTTTCTCCAGAGGCTCTAGGG + Intergenic
1024260637 7:47571571-47571593 CAGTACCTCCAGAGGGTCAAGGG + Intronic
1024745494 7:52400659-52400681 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1024839911 7:53574239-53574261 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1025110708 7:56213808-56213830 CAGTAGCTCCAGAGGCTGTGTGG + Intergenic
1026634482 7:72069450-72069472 CACTCCCTCTGGAGGCTCTAGGG + Intronic
1026975060 7:74492752-74492774 TGCTCCCTCCAGAGGCTCTCGGG + Intronic
1027669404 7:81077307-81077329 CAATCCCTCCAGGGGCTTTAGGG + Intergenic
1028307398 7:89282853-89282875 CGCTTCCTTCAGAGGGTCTAGGG - Intronic
1028710571 7:93903080-93903102 CACTACCATCAGAGTATCTAAGG - Intronic
1029052978 7:97708971-97708993 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1029464240 7:100715426-100715448 CATTCCCTTCAGAGTCTCTATGG + Intergenic
1030046238 7:105499335-105499357 CTCTTCCTCCTGAGTCTCTATGG + Intronic
1030286406 7:107831494-107831516 TACTCCCTCCAGAGATTCTAGGG - Intergenic
1030935856 7:115584662-115584684 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1031079817 7:117247478-117247500 CATTCCCTCCAAAGGCTGTAGGG + Intergenic
1031517113 7:122714991-122715013 TACTCCCTCTAGAAGCTCTAGGG - Intronic
1031716181 7:125111379-125111401 TACTACCTACATAGGCTATATGG + Intergenic
1031879091 7:127176588-127176610 CACTTCCTTCAGAGGGTCTGTGG - Intronic
1031967434 7:128037197-128037219 CACTCCCTCCAGAGGCCGTAGGG + Intronic
1032072282 7:128815606-128815628 CACTACCTCCAGACTCTGTGGGG - Exonic
1032890038 7:136184160-136184182 GGCTCCCTCCAGAGGTTCTAAGG - Intergenic
1033189660 7:139265820-139265842 TGGTCCCTCCAGAGGCTCTAGGG - Intronic
1033412124 7:141127601-141127623 GACTCCTTCCAGAGGCTGTAGGG - Intronic
1033550135 7:142439366-142439388 CATTCCTTCCTGAGGCTCTAGGG + Intergenic
1034341741 7:150361620-150361642 CACTCCCTCCAAAGTCTCTAGGG - Intergenic
1034683329 7:152947705-152947727 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1035293224 7:157853341-157853363 CCTTACCTCCAGTGGCTCTGCGG - Intronic
1035768487 8:2127440-2127462 CTCCACCTCCAGAAGCTCTGGGG + Intronic
1035833742 8:2727090-2727112 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1036544500 8:9753914-9753936 TACTCCCTACAGAGGCTGTAGGG + Intronic
1036732476 8:11277985-11278007 CAGTACCTCCATAGGCTATTTGG - Intergenic
1038062076 8:23924981-23925003 CACTCCCTCTGGAGGCTCTAGGG + Intergenic
1038364182 8:26914442-26914464 CACTCCCTCTGAAGGCTCTAGGG - Intergenic
1038367343 8:26949124-26949146 CACTTCCTTCAGAGGGTCTGAGG + Intergenic
1039485866 8:37909334-37909356 AACTCTGTCCAGAGGCTCTAGGG - Intergenic
1039965913 8:42283627-42283649 TGCTCCATCCAGAGGCTCTAGGG - Intronic
1040025160 8:42775118-42775140 CACTCCCTGTGGAGGCTCTAGGG + Intronic
1040420868 8:47239378-47239400 CACACCCTCCAAAAGCTCTAGGG + Intergenic
1040635804 8:49271167-49271189 CACTACTTTCAGAGGGTCTGTGG + Intergenic
1040711662 8:50195808-50195830 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1041364037 8:57082923-57082945 CACTTCCTGCAGAGGGTCTGTGG - Intergenic
1041570699 8:59333802-59333824 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1042295754 8:67215701-67215723 CATTCCCTCCAAAGGCTCTAAGG - Intronic
1042304273 8:67314663-67314685 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1042467275 8:69141525-69141547 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1042781150 8:72492240-72492262 TGCTTCCTCCAAAGGCTCTAGGG - Intergenic
1043596351 8:81890619-81890641 CACTCCCTCTAGAGGCTCTAGGG + Intergenic
1044634549 8:94309497-94309519 TGCTTCCTCCAGAGACTCTAAGG - Intergenic
1044726846 8:95201349-95201371 CGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1044727749 8:95207199-95207221 CCCTCCCTCCGGAGGCTCCAGGG - Intergenic
1044728791 8:95213968-95213990 CACTCCCTCCAAAGCCTCTAGGG - Intergenic
1044929682 8:97239940-97239962 CCCTCCCTCCAAAGGCTCCAGGG + Intergenic
1045496533 8:102714237-102714259 CACTGCCTCCGAAGGCTCTTGGG + Intergenic
1046074281 8:109298869-109298891 CACTTCCTTCAGAGGGTCTGCGG - Intronic
1046377941 8:113411286-113411308 CTCAACCTCCAGAGACACTAAGG + Intronic
1046526208 8:115385123-115385145 CATTCCCTCTGGAGGCTCTAGGG - Intergenic
1047028512 8:120850822-120850844 CACTCCCTCTGGATGCTCTAGGG + Intergenic
1047108502 8:121761869-121761891 CACTCCTTCCAGAGACTGTAAGG - Intergenic
1047232176 8:123007047-123007069 CACGTCCTCCAAAGGCTCAAGGG + Intergenic
1047303443 8:123634570-123634592 CATTCCCTCCAGAGGCTCTAGGG + Intergenic
1048035221 8:130671516-130671538 TGCTCTCTCCAGAGGCTCTAGGG - Intergenic
1049188393 8:141271518-141271540 CCCTACCTCGAGAGGCTGTGTGG + Intronic
1049772214 8:144388806-144388828 CACGCACTCCAGATGCTCTACGG + Intronic
1050547954 9:6724964-6724986 CACTCCCTCCAGAGGCTCTGGGG + Intronic
1050838643 9:10117481-10117503 CACTCCCTACAAAAGCTCTAGGG + Intronic
1051247709 9:15128400-15128422 CACTGCCTCTAGAGACTCTAAGG - Intergenic
1051550298 9:18320150-18320172 TACTCCCTCTGGAGGCTCTAGGG - Intergenic
1052127716 9:24798404-24798426 TGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1052161240 9:25262529-25262551 CACTCCTTCCAGACACTCTAGGG - Intergenic
1052708321 9:32020751-32020773 CATTTCTTCCAGAAGCTCTAAGG + Intergenic
1052820860 9:33137119-33137141 TAAAACCTCCAGTGGCTCTAAGG + Intronic
1053564728 9:39237093-39237115 TGCTGCCTCCGGAGGCTCTAGGG + Intronic
1053567542 9:39269048-39269070 CACTCCCTACGGAGGCTCTAGGG - Intronic
1053830509 9:42074994-42075016 TGCTGCCTCCGGAGGCTCTAGGG + Intronic
1053833557 9:42109999-42110021 CACTCCCTACGAAGGCTCTAGGG - Intronic
1054129601 9:61349950-61349972 CACTCCCTACGGAGGCTCTAGGG + Intergenic
1054132423 9:61381941-61381963 TGCTGCCTCCGGAGGCTCTAGGG - Intergenic
1054600051 9:67112461-67112483 TGCTGCCTCCGGAGGCTCTAGGG - Intergenic
1055385394 9:75756802-75756824 GGCTTCCTCCAGAGGCTATAGGG - Intergenic
1056280179 9:85034198-85034220 CACTCCCTCTGAAGGCTCTAGGG - Intergenic
1056288191 9:85112604-85112626 CACTCTCTCCAGACACTCTAGGG - Intergenic
1056306701 9:85297933-85297955 CACTCCCTCCAGAGGCTCCAGGG + Intergenic
1056322873 9:85452734-85452756 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1056453200 9:86736244-86736266 CACATCCTCCAGAGGGCCTATGG - Intergenic
1056491659 9:87114073-87114095 CGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1056855032 9:90119951-90119973 CACTTCCTCCAGAGCCTGCAAGG + Intergenic
1056996165 9:91461543-91461565 CACTCCCTCCGGAGGCTCTTGGG + Intergenic
1057073255 9:92118699-92118721 TACTCCCTCCAAAGGCTCTGGGG + Intergenic
1057082289 9:92181849-92181871 CACTACCTCCAAAGGCTCTAGGG + Intergenic
1057742074 9:97720656-97720678 TACTCCCTCCTGAGGCTCTAGGG - Intergenic
1057967455 9:99517967-99517989 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1058222842 9:102324434-102324456 TACTTCGTCCAGAGGCTCTATGG - Intergenic
1058481346 9:105398754-105398776 CAGTACCTCGAGAGGCTCTTTGG + Intronic
1058766297 9:108185751-108185773 TGCTCTCTCCAGAGGCTCTAGGG + Intergenic
1058944946 9:109847366-109847388 CACTCCCTTTGGAGGCTCTAGGG - Intronic
1059058859 9:111014218-111014240 CACAACCTCCAGAGGCCTTGTGG + Intronic
1059441934 9:114312720-114312742 CACTCCCTCCAAAGCCTCAAGGG + Intergenic
1059761624 9:117343127-117343149 CAATTTCTCTAGAGGCTCTAGGG + Intronic
1060225193 9:121786193-121786215 CAGTAACTCCAGACGCTCCAAGG + Intergenic
1060273913 9:122167811-122167833 CATTCCATCCAGAGGCTCTACGG + Intronic
1060562326 9:124556398-124556420 CACTCCTTTCAGAAGCTCTAGGG - Intronic
1060632394 9:125171370-125171392 AACTACCTACAGAGACACTAAGG + Intronic
1061044264 9:128156160-128156182 TGCTTCCTCCAGAGGCTCTCAGG + Intergenic
1061955630 9:133959869-133959891 CCCTCCCTCCAGAGGCACTAGGG - Intronic
1062063414 9:134512310-134512332 CACTCCCTCTGGAGGGTCTAGGG + Intergenic
1062151271 9:135020408-135020430 TGCTCCCTCCAGAAGCTCTAGGG - Intergenic
1062158626 9:135067654-135067676 TCCTCCCTCCAGAGGCTCTAGGG - Intergenic
1062445538 9:136592602-136592624 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1062705115 9:137934540-137934562 CGCTTCCTTCAGAGGGTCTATGG - Intronic
1185452070 X:287971-287993 CACGTCCTCCTGAGGCTCTAGGG + Intronic
1185484854 X:474568-474590 CAGTCCCTCCAGAGGTTCTAGGG + Intergenic
1185484911 X:474925-474947 AGCTCCCTCCAGAGGCCCTAGGG + Intergenic
1185511239 X:666553-666575 TGCTCCCTCCAGAGGCTCTAAGG - Intergenic
1185511260 X:666642-666664 TGCTCCCTCCAGAGGCTCTAAGG - Intergenic
1185511301 X:666820-666842 TGTTCCCTCCAGAGGCTCTAAGG - Intergenic
1185621952 X:1455440-1455462 CGCTCCCTCCGAAGGCTCTAGGG + Intergenic
1185650476 X:1644145-1644167 CATTCCCTCCAGAGGCTCTAGGG - Intergenic
1185653563 X:1666724-1666746 CACTCCCTGTGGAGGCTCTAGGG + Intergenic
1185653673 X:1667403-1667425 GGTTCCCTCCAGAGGCTCTAGGG + Intergenic
1185655794 X:1684541-1684563 TGCTTCCTCCGGAGGCTCTAGGG - Intergenic
1185677086 X:1857893-1857915 TGCTCCCTCCAGAAGCTCTAGGG + Intergenic
1185677316 X:1859467-1859489 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1185680386 X:1884213-1884235 TGCTCCCTCCAGAGACTCTAGGG + Intergenic
1185683507 X:1908404-1908426 CACACCCTCCGGAGGCTCTAAGG + Intergenic
1185691007 X:2155276-2155298 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1185704943 X:2260017-2260039 AGTTCCCTCCAGAGGCTCTAGGG + Intronic
1185794202 X:2950848-2950870 TACTCTCTCCAGAGGCTCTAGGG + Intronic
1185837039 X:3354496-3354518 CACTCTCTCTGGAGGCTCTAGGG + Intergenic
1185888361 X:3802434-3802456 CGCTCCCTCCGAAGGCTCTAGGG - Intergenic
1185918583 X:4063598-4063620 CACTCCCTCCAGGGGTTCCAGGG - Intergenic
1185924488 X:4131544-4131566 CACTTCCCTCAGAGGCCCTAGGG + Intergenic
1185938420 X:4285275-4285297 CACTCCTTCCATGGGCTCTAGGG + Intergenic
1186122705 X:6381150-6381172 CATGCCCTCCGGAGGCTCTAGGG + Intergenic
1186192866 X:7083082-7083104 CACTCCCTCTGTAGGCTCTAGGG - Intronic
1186193356 X:7087369-7087391 CACTCCCTCTCAAGGCTCTAGGG - Intronic
1186274341 X:7923412-7923434 CACTCTCTCCAGAGGCTCCAGGG - Intronic
1186966457 X:14791403-14791425 CACTCCCTCCAGAGGTGCTAGGG - Intergenic
1187561627 X:20408761-20408783 CACTCCCTTTGGAGGCTCTAGGG + Intergenic
1188213275 X:27448092-27448114 TACTCCCTCCAGAGGCCCCAGGG + Intergenic
1189343191 X:40220123-40220145 TACTCCCTCCAAAGCCTCTAAGG + Intergenic
1189380210 X:40497319-40497341 CACTCCATCTGGAGGCTCTAGGG - Intergenic
1189539440 X:41971080-41971102 CACTTCCTTCAGAGGATCTGTGG - Intergenic
1189605960 X:42678291-42678313 GACTCCCTCTGGAGGCTCTAGGG + Intergenic
1189707994 X:43778676-43778698 CCTTACCTCCAGAGCTTCTAGGG + Exonic
1190299645 X:49049508-49049530 CACTCCCTCTGGAGGCTATAAGG - Intergenic
1190891076 X:54568434-54568456 CACTCTCTCCAGAGACTCTAGGG + Intergenic
1192014832 X:67317811-67317833 CACTTCCTTCAGAGGGTGTATGG + Intergenic
1192222937 X:69209806-69209828 TGCTCCTTCCAGAGGCTCTAAGG - Intergenic
1192498433 X:71632337-71632359 TGCTCCCTCCAGAAGCTCTAGGG + Intergenic
1193741625 X:85224165-85224187 CGCTCCCTCCAGAGGCTCTAGGG + Intergenic
1194097923 X:89666165-89666187 CACTGCCTCCACTGTCTCTAGGG - Intergenic
1194299224 X:92163716-92163738 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1194466315 X:94238299-94238321 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1194605564 X:95974534-95974556 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1194927048 X:99837236-99837258 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1194932297 X:99902087-99902109 CACTTCCTTCAGAGGGTCTGTGG + Intergenic
1195235747 X:102896481-102896503 CACTGCCTCCAAAGCCTTTAGGG - Intergenic
1195238870 X:102931237-102931259 CACTGCCTCCAAAAGCTTTAGGG - Intergenic
1196120507 X:112045381-112045403 CACTACCTCCAGAGGCTCTAGGG - Intronic
1196323446 X:114371820-114371842 CATTCCTTCTAGAGGCTCTAGGG + Intergenic
1196685862 X:118509798-118509820 CACTTCCTCCAGAAGCTGTAGGG + Intronic
1197183083 X:123557626-123557648 CACTCTTTCCAGAGACTCTAGGG - Intergenic
1197438019 X:126456313-126456335 CACTACCACCAGAGGCCATGAGG - Intergenic
1197588785 X:128383526-128383548 CACTTCCTTCAGAGGGTCTGTGG - Intergenic
1198642210 X:138768882-138768904 CTCTTCCCTCAGAGGCTCTAGGG - Intronic
1198687671 X:139244752-139244774 CACTTCCTCCAGAGGCTCTAGGG - Intergenic
1199587613 X:149432665-149432687 TACTCCATGCAGAGGCTCTATGG + Intergenic
1199675670 X:150187237-150187259 CATTCCTTCTAGAGGCTCTAGGG + Intergenic
1200041660 X:153375312-153375334 CACTCCCCCCAGAGGCTCTAGGG - Intergenic
1200050982 X:153431602-153431624 CGCTCCCTCCAGAGGCTCTAGGG - Intergenic
1200067861 X:153513130-153513152 CACTCCCCCCAGAAGCTCTAGGG + Intergenic
1200246818 X:154530889-154530911 CACTCCCGCCAGAGGCCCAAGGG - Intergenic
1200450945 Y:3327554-3327576 CACTGCCTCCACTGTCTCTAGGG - Intergenic
1200616828 Y:5388550-5388572 CACTTCCTTCAGAGGGTCTGTGG + Intronic
1201447990 Y:14079418-14079440 CACTCTCTCCAGAGGTTCCAGGG + Intergenic
1201565288 Y:15358877-15358899 CACTCCCTCTCAAGGCTCTAGGG - Intergenic
1201620644 Y:15953310-15953332 AGTTCCCTCCAGAGGCTCTAGGG - Intergenic
1201639296 Y:16161594-16161616 CTCTCCCTCCACAGGCTCCAAGG - Intergenic
1201663517 Y:16423733-16423755 CTCTCCCTCCACAGGCTCCAAGG + Intergenic