ID: 1196123518

View in Genome Browser
Species Human (GRCh38)
Location X:112075724-112075746
Sequence CAAGGGCCTGTTTGATGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 198}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196123518_1196123529 16 Left 1196123518 X:112075724-112075746 CCCCCTCATCAAACAGGCCCTTG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1196123529 X:112075763-112075785 AGGAATGGGGCCATGCACTAAGG 0: 1
1: 0
2: 3
3: 23
4: 265
1196123518_1196123530 23 Left 1196123518 X:112075724-112075746 CCCCCTCATCAAACAGGCCCTTG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1196123530 X:112075770-112075792 GGGCCATGCACTAAGGAATGTGG 0: 1
1: 1
2: 14
3: 109
4: 409
1196123518_1196123527 2 Left 1196123518 X:112075724-112075746 CCCCCTCATCAAACAGGCCCTTG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1196123527 X:112075749-112075771 GGCTTTGAAGTCAGAGGAATGGG 0: 1
1: 0
2: 31
3: 157
4: 678
1196123518_1196123525 -4 Left 1196123518 X:112075724-112075746 CCCCCTCATCAAACAGGCCCTTG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1196123525 X:112075743-112075765 CTTGCTGGCTTTGAAGTCAGAGG 0: 1
1: 2
2: 20
3: 127
4: 643
1196123518_1196123528 3 Left 1196123518 X:112075724-112075746 CCCCCTCATCAAACAGGCCCTTG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1196123528 X:112075750-112075772 GCTTTGAAGTCAGAGGAATGGGG 0: 1
1: 0
2: 6
3: 82
4: 514
1196123518_1196123526 1 Left 1196123518 X:112075724-112075746 CCCCCTCATCAAACAGGCCCTTG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1196123526 X:112075748-112075770 TGGCTTTGAAGTCAGAGGAATGG 0: 1
1: 19
2: 93
3: 356
4: 1036
1196123518_1196123531 24 Left 1196123518 X:112075724-112075746 CCCCCTCATCAAACAGGCCCTTG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1196123531 X:112075771-112075793 GGCCATGCACTAAGGAATGTGGG 0: 1
1: 2
2: 14
3: 135
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196123518 Original CRISPR CAAGGGCCTGTTTGATGAGG GGG (reversed) Intronic
900427281 1:2586510-2586532 CAAGGCCCGGATTGAGGAGGCGG + Intronic
901862521 1:12083967-12083989 CAAGGTCCCATTTGATGAGTTGG + Intronic
901876528 1:12169913-12169935 CCAGGCCCTGGGTGATGAGGAGG - Intronic
903408672 1:23121169-23121191 CAAGGGGCTGTTTGGTCAGTAGG - Intronic
903575666 1:24338151-24338173 AAAAGGCCTGATTGATGCGGGGG - Intronic
904347999 1:29885995-29886017 CCAGGGCTTGTTGGATAAGGAGG - Intergenic
904360607 1:29969199-29969221 CCAGGGAGTGATTGATGAGGAGG - Intergenic
904888029 1:33756477-33756499 GAATGGCCTGTCTGAGGAGGTGG + Intronic
906166388 1:43689562-43689584 CAAGGGCCTGATATGTGAGGAGG + Intronic
906620841 1:47277134-47277156 TAAGGGCCTGAATGATGAGAAGG + Intronic
906658204 1:47564057-47564079 CAAGGGCTTCTTAGAGGAGGTGG - Intergenic
906675600 1:47691356-47691378 CAAGGGCCTGTTGGGTGGAGGGG - Intergenic
907400207 1:54220599-54220621 CAAGGACCTGTCTGTGGAGGGGG - Intronic
907558705 1:55368242-55368264 TAATGCCCTGTTTGATGAAGTGG - Intergenic
907581127 1:55573760-55573782 AAAGGACCAGTTTGATAAGGTGG - Intergenic
908433014 1:64077511-64077533 CAAGGGCCTGCTTTGTGAGTGGG + Intronic
911054993 1:93701640-93701662 CAGGGGCCTGTTTTATGTGGTGG + Intronic
912239022 1:107885627-107885649 CAAGGGCAGGTTAAATGAGGAGG - Intronic
916191362 1:162181626-162181648 CAAGGGCCTTTTGAATTAGGGGG + Intronic
917798618 1:178550867-178550889 AAAGGGGCTGTTTAAAGAGGTGG + Intergenic
921670295 1:217917455-217917477 CCAGGGCCTGTCTGAGCAGGAGG - Intergenic
922460843 1:225813369-225813391 CAAGGGGCTGTGGGATAAGGTGG + Intronic
923060701 1:230470786-230470808 CCAGGGCCTGTTGGAGGATGAGG - Intergenic
923462296 1:234217768-234217790 AAAGGGCCTTTTTGAGGAAGAGG + Intronic
1063455006 10:6176868-6176890 TAAGGGCTTGTTTGAAGAGAGGG - Intronic
1064155304 10:12898637-12898659 GAAGGCCTTGTTTGAGGAGGAGG - Exonic
1066055585 10:31677678-31677700 CAAAGGCCTGTGTGAGGAAGGGG - Intergenic
1067375002 10:45719845-45719867 CAAGGGGCTCTTTGATGATGAGG - Intergenic
1067378725 10:45752676-45752698 CAAGGGGCTATTTGATGATGAGG + Exonic
1067456990 10:46426058-46426080 CACAGGCCTGTTAGAGGAGGAGG + Intergenic
1067630213 10:47958581-47958603 CACAGGCCTGTTAGAGGAGGAGG - Intergenic
1067882816 10:50061486-50061508 CAAGGGGCTCTTTGATGATGAGG - Intergenic
1067886424 10:50093356-50093378 CAAGGGGCTCTTTGATGATGAGG + Exonic
1068623342 10:59210911-59210933 CCAGGGCCTGTTTGGGGATGGGG + Intronic
1069843479 10:71354740-71354762 GAAGGGCCTGATGGATGAGCTGG - Intronic
1070728471 10:78808580-78808602 CAAGGGCCCGTCTGATCAGAAGG + Intergenic
1070800130 10:79240262-79240284 CAAGTGCCTGTGAGCTGAGGTGG + Intronic
1071360818 10:84844329-84844351 CAAAGGCCTGCTTGATGAGGTGG - Intergenic
1071951352 10:90706014-90706036 CCAGGGCCTGTTGGAGGATGGGG + Intergenic
1072888273 10:99299216-99299238 CCAGGGCGTGTTGGATGAGGGGG - Intergenic
1074352943 10:112755947-112755969 CAAGGGCTTCTTTGATGAAAGGG + Intronic
1076151643 10:128167211-128167233 CCAGGGCCTGTCAGGTGAGGGGG - Intergenic
1077501181 11:2910423-2910445 CTAGGGCCTGTCTGAGGAGGCGG + Intronic
1081646621 11:44794810-44794832 AAAGCGCCTGTCTGATGAAGTGG + Intronic
1083668191 11:64286354-64286376 CAAGGGTCTCTCTGTTGAGGAGG + Intronic
1084403648 11:68959046-68959068 CAAAGGCCTCTCTGAAGAGGTGG + Intergenic
1085387047 11:76163463-76163485 CACGTGCCTGTTAGATCAGGGGG + Intergenic
1088101692 11:106163044-106163066 CAAGGGCATATTTGAGGAGTAGG - Intergenic
1091035063 11:132225431-132225453 CAAGGGCTTGTATGAAGAGAGGG + Intronic
1091779523 12:3205096-3205118 CAAGTTCCTGTCTGATGTGGAGG + Intronic
1093381749 12:18501285-18501307 CAAGGGCCTTTTTCACAAGGTGG + Intronic
1095249186 12:39958630-39958652 TCAGGGCCTGTTTCATGAAGGGG + Intronic
1096470427 12:51872018-51872040 CAAAGGCCTTCTTGAGGAGGGGG + Intergenic
1096552388 12:52381405-52381427 CAAGGCCCAGTATGAGGAGGTGG - Exonic
1097178537 12:57157666-57157688 CAAGGGCCTCTCTGAGGATGTGG + Intronic
1100270390 12:93019079-93019101 CAATGGCCTGCTTGAAGAGAGGG - Intergenic
1103193252 12:119020336-119020358 CAATGGGCTATTTAATGAGGAGG - Intronic
1103597516 12:122032590-122032612 CAAGGGACCGTTTGATTTGGAGG + Intronic
1105799504 13:23891336-23891358 CAATGGCTTGTTTGCTGATGAGG - Exonic
1105849543 13:24321699-24321721 CAATGGCTTGTTTGCTGATGAGG + Exonic
1106032836 13:26018134-26018156 CAAGGGCTTGTCTGCAGAGGTGG - Intronic
1107549400 13:41460654-41460676 CAAGGCCCTGGGTGATGAGTGGG + Intronic
1108563476 13:51670559-51670581 CAAATGCCTGTTTGAAGGGGTGG + Intronic
1109954965 13:69553667-69553689 CAAGGGCCTGTTTGTGGGGTGGG + Intergenic
1110151468 13:72260006-72260028 GAAGCACCTGTTTGATGAGAGGG + Intergenic
1110790822 13:79584802-79584824 CAGGGGCCTGATTTATGTGGTGG - Intergenic
1111982308 13:95029927-95029949 CTGGGGCCTGTTTGAATAGGTGG - Intronic
1115631537 14:35250710-35250732 TAGGGGCCTATTTGATAAGGTGG - Intronic
1118685022 14:68282633-68282655 CAAGAGCATATCTGATGAGGTGG + Intronic
1119174024 14:72555997-72556019 CATGGGCCTGTTTGATGGAATGG - Intronic
1120984301 14:90320305-90320327 CAAGGACCTTCTTGATGTGGTGG + Intronic
1121680367 14:95788274-95788296 GAAGGTGGTGTTTGATGAGGAGG - Intergenic
1122959035 14:105086128-105086150 CACCGGCCTGTTAGAGGAGGAGG - Intergenic
1124872995 15:33562072-33562094 GGAGGCCCTGATTGATGAGGAGG + Intronic
1124971112 15:34490428-34490450 CAGGGGCCTGATTGACGATGTGG - Intergenic
1125732448 15:41900764-41900786 CGACGGCATGCTTGATGAGGAGG - Exonic
1128577243 15:68784409-68784431 GGAGGGCCTGGATGATGAGGAGG - Exonic
1128882510 15:71256678-71256700 CATGGGCCGGTTTTATGAGTGGG + Exonic
1129392192 15:75226063-75226085 CAAGGGCCAGTGTGACGAGCAGG + Intergenic
1129710002 15:77816105-77816127 CAAGGGGCTGTTTCAGAAGGAGG - Intronic
1130017546 15:80199603-80199625 GAAGGCCCTGTATGATGGGGAGG - Intergenic
1130519064 15:84648420-84648442 CATGTGCCTGTGTGCTGAGGGGG + Intronic
1136157350 16:28392039-28392061 CAAGCGCCTGGATGAGGAGGAGG - Exonic
1136205737 16:28723245-28723267 CAAGCGCCTGGATGAGGAGGAGG + Exonic
1136268285 16:29133353-29133375 CAGGAGCCTGCTTGATGTGGAGG - Intergenic
1136451395 16:30356044-30356066 CTAGGCCCTGTTTGCTCAGGGGG - Intergenic
1138824416 16:60301852-60301874 CAAGTGACTGTTTGATGAATTGG - Intergenic
1140118255 16:72061437-72061459 CATGGGCCTGGTTGAGGAAGAGG + Intronic
1142071589 16:88093687-88093709 CAGGAGCCTGCTTGATGGGGAGG - Intronic
1145102375 17:20087845-20087867 CCAGGGGCTGTTTGGTGGGGTGG + Intronic
1149503726 17:57175373-57175395 CAAGGGCCTTTTTGATGTTCTGG + Intergenic
1149632122 17:58134922-58134944 TAAGAGCATTTTTGATGAGGAGG + Intergenic
1152715713 17:81899608-81899630 CAGGGGCCTCTCTGAGGAGGTGG - Intronic
1153260461 18:3219006-3219028 CAAGGGCTTACTTGATGAAGAGG - Intronic
1153817849 18:8806663-8806685 TGAGGGCCTGTTTGATCAGGAGG - Intronic
1155848314 18:30736935-30736957 CCAGGGCCTGTTTGGGGTGGTGG + Intergenic
1157131692 18:45013335-45013357 CAAAGGCCTGTTTGTAGAGCTGG + Intronic
1158204380 18:54975431-54975453 CTAGGGCCTTTTTGGAGAGGTGG - Intergenic
1161475185 19:4480742-4480764 CAAGAGCCTGTTGTATGAGCGGG + Intronic
1165392887 19:35548452-35548474 CAACGGCCTGGTGGAGGAGGAGG - Intergenic
1165403934 19:35618649-35618671 CCAGGGCCTGGTGGAGGAGGTGG + Exonic
1166679990 19:44760056-44760078 CATGGGCCTCTTTCATGAGATGG + Intergenic
926224667 2:10958506-10958528 CAAGGGGATGATTGTTGAGGAGG + Intergenic
928323218 2:30300360-30300382 TCAGGGCCTGTCTGATGAGATGG + Intronic
932078149 2:68685925-68685947 CAAGGGCCTGTTGGGGGATGGGG - Intronic
933167938 2:79095755-79095777 CAAGGGCCTGTCTAAGAAGGTGG + Intergenic
934684773 2:96312931-96312953 CAAGAGGCAGTTTCATGAGGTGG + Intergenic
934723764 2:96601858-96601880 CAAGGGACTGTGTTATGTGGGGG - Intronic
936444708 2:112586465-112586487 CAAAGGCCTGTGTGGTGATGGGG - Intronic
940066513 2:149636042-149636064 CCAGGGCCTGTTGGGTGTGGGGG - Intergenic
940555698 2:155225859-155225881 CCAGGGCCTGTCTGAGGGGGTGG - Intergenic
940903381 2:159147091-159147113 CATGGCCCTGTTTGTTGTGGAGG + Intronic
941995932 2:171601946-171601968 AAAGGGCCTTGATGATGAGGAGG + Intergenic
945724178 2:213455351-213455373 CAAGGGGATGTTTGGTGGGGAGG - Intronic
946426615 2:219601785-219601807 GAAGAGCCTCTTTGGTGAGGAGG + Intronic
948841666 2:240653581-240653603 TAAGGGCTTGATTGATGAGAGGG + Intergenic
1169703582 20:8476885-8476907 CAATGGCCTATATGATGGGGTGG - Intronic
1169739186 20:8871603-8871625 CAAGGCCCTGTTTGGTGTTGTGG - Intronic
1170125870 20:12963532-12963554 AGAGGGTCTCTTTGATGAGGAGG - Intergenic
1170846344 20:19965052-19965074 CAAGGCCCTGTTTGGTGTGTGGG + Intronic
1171020972 20:21583759-21583781 CAAGGGCCTGTTCTCTGAGGGGG - Intergenic
1171798023 20:29581583-29581605 CAAGGGCGTGCCAGATGAGGGGG - Intergenic
1172447637 20:35001505-35001527 CAAGCGCCAGTTTGAGGAGGCGG + Exonic
1176511838 21:7754637-7754659 CAAGGGCCTGGGTGATCAGCAGG + Intronic
1178645951 21:34385163-34385185 CAAGGGCCTGGGTGATCAGCAGG + Intronic
1181098153 22:20520300-20520322 AAAGGTCATGTCTGATGAGGAGG - Intronic
1181744540 22:24946696-24946718 CAAGGGCATGCTTGATGAACTGG + Intergenic
1182276995 22:29196013-29196035 GAAGGGCCTGTCTCAGGAGGTGG - Intergenic
1183383792 22:37503589-37503611 CAAGGAGGTGTCTGATGAGGAGG - Intronic
1183492314 22:38123140-38123162 CAAGGACCTGTTTGACTGGGTGG - Exonic
1184901681 22:47450327-47450349 CATGGGCCTGTTGGATTAGATGG - Intergenic
950983076 3:17330145-17330167 GAAGGGCCTGGTAGATGGGGAGG - Intronic
951236296 3:20240342-20240364 CCAGGGCCAGTTTGATGACCTGG + Intergenic
951922898 3:27875327-27875349 CAAGAGCCTATTTGGGGAGGAGG - Intergenic
952389384 3:32866687-32866709 CAAGGGCCTGTGTGATTGTGGGG + Intronic
952924536 3:38311393-38311415 CAAGCTACTGTTTGATAAGGAGG - Intronic
954388712 3:50258008-50258030 CAATGGCCTGGTGGGTGAGGAGG - Intronic
955175999 3:56613246-56613268 CAAGGGGCTGTTTGATGGTTAGG + Intronic
955444355 3:58993589-58993611 CTAGGGCCTGTTGGAGGATGGGG - Intronic
956624037 3:71249244-71249266 CAAGGCCCTGTTTGCTGGGTTGG - Intronic
957801095 3:85082796-85082818 CAAAGGCATATTTGATGATGGGG + Intronic
957938421 3:86973701-86973723 GGAGGGCCTGTCTGATGAGCTGG - Intronic
958260718 3:91377888-91377910 CCAGGGCCTGTTTGGGGGGGTGG - Intergenic
958955660 3:100463617-100463639 AAAAAGCCTGTCTGATGAGGTGG + Intergenic
960277227 3:115742144-115742166 CCAGACCCTGTCTGATGAGGAGG + Intergenic
964242777 3:154616148-154616170 CCAGGGCATGTTTGCAGAGGGGG - Intergenic
966443391 3:179973574-179973596 CAAGAGCTTTTATGATGAGGAGG - Intronic
968184597 3:196623504-196623526 CCAGGGCCTGTTTGGGAAGGAGG + Intergenic
972073838 4:35057942-35057964 CTAGGGCCTGTTGGAGGTGGAGG + Intergenic
973154646 4:46935656-46935678 CTAGGGCCTGTTTGGGGTGGGGG + Intronic
973585187 4:52383613-52383635 CCAGGGCCTGTTGGAGGATGGGG + Intergenic
974214234 4:58824414-58824436 CAAGAGACTGTGTCATGAGGTGG + Intergenic
975126963 4:70793830-70793852 CAAAGTCCTGTTTGAAGAGCCGG - Exonic
976299854 4:83507288-83507310 CAAGGGCCTGTCTGAAAAGGTGG + Intronic
979378907 4:119984755-119984777 CAAGGGCCTGATAAAGGAGGTGG + Intergenic
979533328 4:121792367-121792389 GAGAGGCCTCTTTGATGAGGGGG - Intergenic
992358321 5:76008921-76008943 GAAGGGCCTGTTTGAAGAACAGG - Intergenic
994257650 5:97618369-97618391 CTAGGGCCTACTTGATGAGGGGG - Intergenic
994947617 5:106416031-106416053 CAAAGTCCTGTTTGAAGAGCCGG + Intergenic
999138057 5:149336566-149336588 CAAGGGCCTTCTTGCTGATGGGG + Intronic
999186592 5:149715241-149715263 GAAGGGCCTCTCTGAGGAGGTGG + Intergenic
999730488 5:154473571-154473593 CGCGGGCCTGTTTGATCTGGCGG + Intergenic
1000009057 5:157214867-157214889 CAAGGGCAAGTTTGAAGAGGAGG - Intronic
1000479028 5:161747933-161747955 CCAGGGCCTGTTGGAGGATGGGG - Intergenic
1001097313 5:168785923-168785945 CAAGGGACTGTTTGATGGGCTGG - Exonic
1003272828 6:4622572-4622594 CAAGGGCTTGTTTGCTAATGGGG - Intergenic
1005012454 6:21348717-21348739 CAAGGGCCTGGGTGACAAGGAGG - Intergenic
1006205248 6:32335640-32335662 CAAGGGATTTTTAGATGAGGAGG - Intronic
1006624266 6:35386113-35386135 CAAGGGCCTCTTAGATGGCGGGG + Intronic
1007694048 6:43720338-43720360 CAATAGCCTGTTTGCTGAGCTGG + Intergenic
1007782294 6:44261578-44261600 TTAGGGCCTGTGGGATGAGGAGG - Intronic
1008548264 6:52602906-52602928 CAAGGTGGTGTTTGCTGAGGTGG + Intergenic
1010517145 6:76786930-76786952 CAAGGGCCTGTTGGGGGATGGGG + Intergenic
1013164922 6:107581114-107581136 CAAGGACCTGTTTGATTAGTGGG + Intronic
1013411787 6:109889720-109889742 CGAGGGCCTGTTTGCTGGCGAGG - Intergenic
1014194074 6:118532341-118532363 CCAGGGCCTACTTGATGAGGGGG + Intronic
1015481857 6:133720615-133720637 AAAAGGCCTCTTTGATAAGGTGG - Intergenic
1018682428 6:166275385-166275407 CAGGGTCCTGTTGGCTGAGGAGG + Intergenic
1024838156 7:53548969-53548991 CAAGAGTCTGTTTAATGACGTGG + Intergenic
1027573890 7:79907452-79907474 TTAGGGCCTGTATGTTGAGGTGG + Intergenic
1027880124 7:83824001-83824023 CCAGGGCCTGTTGGAGGAGTAGG - Intergenic
1030480467 7:110097191-110097213 CAAGGGCTTTTCTGATGTGGTGG - Intergenic
1031693472 7:124818845-124818867 CAAGAGCCTGTGTGACAAGGGGG + Intergenic
1032269705 7:130393221-130393243 CAAGGGCGAGTGGGATGAGGTGG + Intergenic
1032540648 7:132700265-132700287 GAAGGGCCTGTTTACTGGGGAGG + Intronic
1033287083 7:140050449-140050471 GAAGGTCCTGCTTGGTGAGGTGG - Intronic
1033686178 7:143643193-143643215 CCAGGGCCAGATTGAGGAGGAGG - Intronic
1033689560 7:143724122-143724144 CCAGGGCCAGATTGAGGAGGAGG + Intronic
1033698435 7:143814428-143814450 CCAGGGCCAGATTGAGGAGGAGG + Intergenic
1035782808 8:2242263-2242285 CTAGGGCCTGTTGGAGGTGGGGG + Intergenic
1035809322 8:2477322-2477344 CTAGGGCCTGTTGGAGGTGGGGG - Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1042158214 8:65866711-65866733 CAAGGGCCTGTCTGAAAAGATGG - Intergenic
1044479275 8:92666389-92666411 CCAGGGCCTGTTGGATGTTGGGG - Intergenic
1047209924 8:122832987-122833009 CAAGGGCCTGTACGAAGAGGTGG + Intronic
1048995600 8:139792031-139792053 CAAGAGCCTGTTTTATTTGGGGG - Intronic
1049642936 8:143723507-143723529 CCAGGGGCTGTTTCCTGAGGGGG + Intergenic
1050134142 9:2443573-2443595 CTGGGGCCTGTTGGAGGAGGTGG - Intergenic
1052738912 9:32374800-32374822 CAAGGGCCTCATTGATCTGGTGG + Intergenic
1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG + Intergenic
1053427827 9:38022622-38022644 CTAGGGCCTGTGTTATGGGGGGG - Intronic
1053787993 9:41665871-41665893 CAAGGGCATGCCAGATGAGGGGG + Intergenic
1054157139 9:61648897-61648919 CAAGGGCATGCCAGATGAGGGGG - Intergenic
1054176269 9:61877213-61877235 CAAGGGCATGCCAGATGAGGGGG + Intergenic
1054476914 9:65579902-65579924 CAAGGGCATGCCAGATGAGGGGG - Intergenic
1054661270 9:67703595-67703617 CAAGGGCATGCCAGATGAGGGGG - Intergenic
1055599695 9:77903024-77903046 CAATGGTCTGTTAGATGAAGAGG + Intronic
1061904599 9:133690309-133690331 CAAGGGCCTGTTGGAGGACCTGG + Intronic
1203783871 EBV:116310-116332 CGAGGCCCTCTTTGATCAGGAGG - Intergenic
1189942287 X:46137209-46137231 GTAGGACCTGTTTGATGAGGTGG + Intergenic
1193318918 X:80097462-80097484 CCAGGGCCTGTTGGGTGGGGGGG + Intergenic
1194838978 X:98715333-98715355 CAGGGGCCTGTCTGGTGAAGGGG + Intergenic
1194957155 X:100194422-100194444 AAAGGGGCTGTTTGTTGTGGTGG + Intergenic
1195508812 X:105690055-105690077 CCAGGGCCTGTTGGAGGATGGGG + Intronic
1195707320 X:107747248-107747270 CCAGGGCGTGTGTGATAAGGGGG - Intronic
1196123518 X:112075724-112075746 CAAGGGCCTGTTTGATGAGGGGG - Intronic
1197981736 X:132224467-132224489 CAAGGCCATATTTGATGTGGTGG + Intergenic
1198821484 X:140652743-140652765 TCACAGCCTGTTTGATGAGGGGG - Intergenic
1200060241 X:153480791-153480813 CAAGGGCCTGGTCGCTGAGTGGG + Intronic
1200950920 Y:8899524-8899546 CAAGGGCCTGATTTATTGGGTGG - Intergenic