ID: 1196127549

View in Genome Browser
Species Human (GRCh38)
Location X:112115428-112115450
Sequence TGTTAGGCCTCAAAATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196127543_1196127549 -7 Left 1196127543 X:112115412-112115434 CCTTGTCCTATAAAGATGTTAGG No data
Right 1196127549 X:112115428-112115450 TGTTAGGCCTCAAAATGGAGGGG No data
1196127541_1196127549 -1 Left 1196127541 X:112115406-112115428 CCTTACCCTTGTCCTATAAAGAT No data
Right 1196127549 X:112115428-112115450 TGTTAGGCCTCAAAATGGAGGGG No data
1196127540_1196127549 15 Left 1196127540 X:112115390-112115412 CCTGCTAGTATTGGGACCTTACC No data
Right 1196127549 X:112115428-112115450 TGTTAGGCCTCAAAATGGAGGGG No data
1196127542_1196127549 -6 Left 1196127542 X:112115411-112115433 CCCTTGTCCTATAAAGATGTTAG No data
Right 1196127549 X:112115428-112115450 TGTTAGGCCTCAAAATGGAGGGG No data
1196127537_1196127549 29 Left 1196127537 X:112115376-112115398 CCTAAGCATTTTTTCCTGCTAGT No data
Right 1196127549 X:112115428-112115450 TGTTAGGCCTCAAAATGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196127549 Original CRISPR TGTTAGGCCTCAAAATGGAG GGG Intergenic
No off target data available for this crispr