ID: 1196129728

View in Genome Browser
Species Human (GRCh38)
Location X:112142372-112142394
Sequence TCCCTGTGGATTATATTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196129728_1196129736 17 Left 1196129728 X:112142372-112142394 CCACAAAATATAATCCACAGGGA No data
Right 1196129736 X:112142412-112142434 TGATGGTGGAAGGATTTAATGGG No data
1196129728_1196129731 3 Left 1196129728 X:112142372-112142394 CCACAAAATATAATCCACAGGGA No data
Right 1196129731 X:112142398-112142420 TAATCTTCCTATCCTGATGGTGG No data
1196129728_1196129735 16 Left 1196129728 X:112142372-112142394 CCACAAAATATAATCCACAGGGA No data
Right 1196129735 X:112142411-112142433 CTGATGGTGGAAGGATTTAATGG No data
1196129728_1196129732 7 Left 1196129728 X:112142372-112142394 CCACAAAATATAATCCACAGGGA No data
Right 1196129732 X:112142402-112142424 CTTCCTATCCTGATGGTGGAAGG No data
1196129728_1196129730 0 Left 1196129728 X:112142372-112142394 CCACAAAATATAATCCACAGGGA No data
Right 1196129730 X:112142395-112142417 CTATAATCTTCCTATCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196129728 Original CRISPR TCCCTGTGGATTATATTTTG TGG (reversed) Intergenic
No off target data available for this crispr