ID: 1196129729

View in Genome Browser
Species Human (GRCh38)
Location X:112142386-112142408
Sequence TAGGAAGATTATAGTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196129729_1196129732 -7 Left 1196129729 X:112142386-112142408 CCACAGGGACTATAATCTTCCTA No data
Right 1196129732 X:112142402-112142424 CTTCCTATCCTGATGGTGGAAGG No data
1196129729_1196129735 2 Left 1196129729 X:112142386-112142408 CCACAGGGACTATAATCTTCCTA No data
Right 1196129735 X:112142411-112142433 CTGATGGTGGAAGGATTTAATGG No data
1196129729_1196129736 3 Left 1196129729 X:112142386-112142408 CCACAGGGACTATAATCTTCCTA No data
Right 1196129736 X:112142412-112142434 TGATGGTGGAAGGATTTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196129729 Original CRISPR TAGGAAGATTATAGTCCCTG TGG (reversed) Intergenic
No off target data available for this crispr