ID: 1196129732

View in Genome Browser
Species Human (GRCh38)
Location X:112142402-112142424
Sequence CTTCCTATCCTGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196129729_1196129732 -7 Left 1196129729 X:112142386-112142408 CCACAGGGACTATAATCTTCCTA No data
Right 1196129732 X:112142402-112142424 CTTCCTATCCTGATGGTGGAAGG No data
1196129728_1196129732 7 Left 1196129728 X:112142372-112142394 CCACAAAATATAATCCACAGGGA No data
Right 1196129732 X:112142402-112142424 CTTCCTATCCTGATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196129732 Original CRISPR CTTCCTATCCTGATGGTGGA AGG Intergenic
No off target data available for this crispr