ID: 1196129732 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:112142402-112142424 |
| Sequence | CTTCCTATCCTGATGGTGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1196129729_1196129732 | -7 | Left | 1196129729 | X:112142386-112142408 | CCACAGGGACTATAATCTTCCTA | No data | ||
| Right | 1196129732 | X:112142402-112142424 | CTTCCTATCCTGATGGTGGAAGG | No data | ||||
| 1196129728_1196129732 | 7 | Left | 1196129728 | X:112142372-112142394 | CCACAAAATATAATCCACAGGGA | No data | ||
| Right | 1196129732 | X:112142402-112142424 | CTTCCTATCCTGATGGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1196129732 | Original CRISPR | CTTCCTATCCTGATGGTGGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||