ID: 1196130138

View in Genome Browser
Species Human (GRCh38)
Location X:112146609-112146631
Sequence CAGGGAAATGAGGAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196130125_1196130138 29 Left 1196130125 X:112146557-112146579 CCCGAGCTCTGAGGCAATCCAAA No data
Right 1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG No data
1196130126_1196130138 28 Left 1196130126 X:112146558-112146580 CCGAGCTCTGAGGCAATCCAAAG No data
Right 1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG No data
1196130131_1196130138 11 Left 1196130131 X:112146575-112146597 CCAAAGGCTAATGGTCAGGGAAA No data
Right 1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196130138 Original CRISPR CAGGGAAATGAGGAGGAAGC AGG Intergenic
No off target data available for this crispr