ID: 1196132442

View in Genome Browser
Species Human (GRCh38)
Location X:112171972-112171994
Sequence TCTGATATCCAGAGTGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196132441_1196132442 -9 Left 1196132441 X:112171958-112171980 CCATCTGACAAAGGTCTGATATC 0: 29
1: 1203
2: 5577
3: 3321
4: 1595
Right 1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG No data
1196132439_1196132442 24 Left 1196132439 X:112171925-112171947 CCTATAGAATGAGAGAGAACTTT No data
Right 1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196132442 Original CRISPR TCTGATATCCAGAGTGTAGA AGG Intergenic
No off target data available for this crispr