ID: 1196133655

View in Genome Browser
Species Human (GRCh38)
Location X:112183700-112183722
Sequence CTTAAACAAATGTAGATGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196133650_1196133655 0 Left 1196133650 X:112183677-112183699 CCTACCAAGAGACTTAGACTCCT No data
Right 1196133655 X:112183700-112183722 CTTAAACAAATGTAGATGGCGGG No data
1196133648_1196133655 29 Left 1196133648 X:112183648-112183670 CCCAGATTCATAAAGCAAGTTCT 0: 1495
1: 7826
2: 3000
3: 1203
4: 1047
Right 1196133655 X:112183700-112183722 CTTAAACAAATGTAGATGGCGGG No data
1196133649_1196133655 28 Left 1196133649 X:112183649-112183671 CCAGATTCATAAAGCAAGTTCTT 0: 1458
1: 4602
2: 5458
3: 1599
4: 844
Right 1196133655 X:112183700-112183722 CTTAAACAAATGTAGATGGCGGG No data
1196133651_1196133655 -4 Left 1196133651 X:112183681-112183703 CCAAGAGACTTAGACTCCTCTTA No data
Right 1196133655 X:112183700-112183722 CTTAAACAAATGTAGATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196133655 Original CRISPR CTTAAACAAATGTAGATGGC GGG Intergenic
No off target data available for this crispr