ID: 1196135968

View in Genome Browser
Species Human (GRCh38)
Location X:112209837-112209859
Sequence GACAGCTCTTGGACTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196135968_1196135973 16 Left 1196135968 X:112209837-112209859 CCAGTAACAGTCCAAGAGCTGTC No data
Right 1196135973 X:112209876-112209898 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
1196135968_1196135971 11 Left 1196135968 X:112209837-112209859 CCAGTAACAGTCCAAGAGCTGTC No data
Right 1196135971 X:112209871-112209893 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
1196135968_1196135972 15 Left 1196135968 X:112209837-112209859 CCAGTAACAGTCCAAGAGCTGTC No data
Right 1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196135968 Original CRISPR GACAGCTCTTGGACTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr