ID: 1196145005

View in Genome Browser
Species Human (GRCh38)
Location X:112306837-112306859
Sequence CAGTGGCCACAGCAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196144999_1196145005 15 Left 1196144999 X:112306799-112306821 CCGTAGGAAACTCTACGCTCAAG No data
Right 1196145005 X:112306837-112306859 CAGTGGCCACAGCAGGAAGCTGG No data
1196144998_1196145005 18 Left 1196144998 X:112306796-112306818 CCTCCGTAGGAAACTCTACGCTC No data
Right 1196145005 X:112306837-112306859 CAGTGGCCACAGCAGGAAGCTGG No data
1196144997_1196145005 21 Left 1196144997 X:112306793-112306815 CCTCCTCCGTAGGAAACTCTACG No data
Right 1196145005 X:112306837-112306859 CAGTGGCCACAGCAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196145005 Original CRISPR CAGTGGCCACAGCAGGAAGC TGG Intergenic
No off target data available for this crispr