ID: 1196154992

View in Genome Browser
Species Human (GRCh38)
Location X:112418927-112418949
Sequence CCTCATATATTGAAGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196154988_1196154992 14 Left 1196154988 X:112418890-112418912 CCCTTTAAAAAATACTGATTTTG No data
Right 1196154992 X:112418927-112418949 CCTCATATATTGAAGGACAATGG No data
1196154986_1196154992 27 Left 1196154986 X:112418877-112418899 CCAAATTGGATTCCCCTTTAAAA No data
Right 1196154992 X:112418927-112418949 CCTCATATATTGAAGGACAATGG No data
1196154987_1196154992 15 Left 1196154987 X:112418889-112418911 CCCCTTTAAAAAATACTGATTTT No data
Right 1196154992 X:112418927-112418949 CCTCATATATTGAAGGACAATGG No data
1196154989_1196154992 13 Left 1196154989 X:112418891-112418913 CCTTTAAAAAATACTGATTTTGT No data
Right 1196154992 X:112418927-112418949 CCTCATATATTGAAGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196154992 Original CRISPR CCTCATATATTGAAGGACAA TGG Intergenic
No off target data available for this crispr