ID: 1196157176 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:112443111-112443133 |
| Sequence | CTGCAGAGATAGAGAGTAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1196157176_1196157177 | 13 | Left | 1196157176 | X:112443111-112443133 | CCTTCTACTCTCTATCTCTGCAG | No data | ||
| Right | 1196157177 | X:112443147-112443169 | GATTTTTATATCCAACAAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1196157176 | Original CRISPR | CTGCAGAGATAGAGAGTAGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||