ID: 1196157176

View in Genome Browser
Species Human (GRCh38)
Location X:112443111-112443133
Sequence CTGCAGAGATAGAGAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196157176_1196157177 13 Left 1196157176 X:112443111-112443133 CCTTCTACTCTCTATCTCTGCAG No data
Right 1196157177 X:112443147-112443169 GATTTTTATATCCAACAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196157176 Original CRISPR CTGCAGAGATAGAGAGTAGA AGG (reversed) Intergenic
No off target data available for this crispr