ID: 1196161456

View in Genome Browser
Species Human (GRCh38)
Location X:112488515-112488537
Sequence TTGTTGTTCCTGAGGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196161449_1196161456 24 Left 1196161449 X:112488468-112488490 CCTCCAAGACGTCAGGGATTGTA No data
Right 1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG No data
1196161452_1196161456 -7 Left 1196161452 X:112488499-112488521 CCTAACCTAAGGATAATTGTTGT No data
Right 1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG No data
1196161450_1196161456 21 Left 1196161450 X:112488471-112488493 CCAAGACGTCAGGGATTGTATTA No data
Right 1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196161456 Original CRISPR TTGTTGTTCCTGAGGAAGAA GGG Intergenic
No off target data available for this crispr