ID: 1196166456

View in Genome Browser
Species Human (GRCh38)
Location X:112540217-112540239
Sequence GGCACAAATGACAGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196166456_1196166458 -7 Left 1196166456 X:112540217-112540239 CCTGCCTCACTGTCATTTGTGCC No data
Right 1196166458 X:112540233-112540255 TTGTGCCCTTTCACAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196166456 Original CRISPR GGCACAAATGACAGTGAGGC AGG (reversed) Intergenic