ID: 1196168934

View in Genome Browser
Species Human (GRCh38)
Location X:112565837-112565859
Sequence AATCTTGGCAGCTCCAGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196168934_1196168944 22 Left 1196168934 X:112565837-112565859 CCGAAGCTGGAGCTGCCAAGATT No data
Right 1196168944 X:112565882-112565904 GCACAGAGCAGCGGGGGACCTGG No data
1196168934_1196168943 16 Left 1196168934 X:112565837-112565859 CCGAAGCTGGAGCTGCCAAGATT No data
Right 1196168943 X:112565876-112565898 GAAGCTGCACAGAGCAGCGGGGG No data
1196168934_1196168941 14 Left 1196168934 X:112565837-112565859 CCGAAGCTGGAGCTGCCAAGATT No data
Right 1196168941 X:112565874-112565896 CTGAAGCTGCACAGAGCAGCGGG No data
1196168934_1196168940 13 Left 1196168934 X:112565837-112565859 CCGAAGCTGGAGCTGCCAAGATT No data
Right 1196168940 X:112565873-112565895 CCTGAAGCTGCACAGAGCAGCGG No data
1196168934_1196168942 15 Left 1196168934 X:112565837-112565859 CCGAAGCTGGAGCTGCCAAGATT No data
Right 1196168942 X:112565875-112565897 TGAAGCTGCACAGAGCAGCGGGG No data
1196168934_1196168946 28 Left 1196168934 X:112565837-112565859 CCGAAGCTGGAGCTGCCAAGATT No data
Right 1196168946 X:112565888-112565910 AGCAGCGGGGGACCTGGGCCTGG No data
1196168934_1196168945 23 Left 1196168934 X:112565837-112565859 CCGAAGCTGGAGCTGCCAAGATT No data
Right 1196168945 X:112565883-112565905 CACAGAGCAGCGGGGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196168934 Original CRISPR AATCTTGGCAGCTCCAGCTT CGG (reversed) Intergenic
No off target data available for this crispr