ID: 1196174324

View in Genome Browser
Species Human (GRCh38)
Location X:112624409-112624431
Sequence GATTTTGGCAGAAGCGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196174318_1196174324 11 Left 1196174318 X:112624375-112624397 CCCAGGGAAGGAAAAACATCAGA No data
Right 1196174324 X:112624409-112624431 GATTTTGGCAGAAGCGCTGGTGG No data
1196174319_1196174324 10 Left 1196174319 X:112624376-112624398 CCAGGGAAGGAAAAACATCAGAG No data
Right 1196174324 X:112624409-112624431 GATTTTGGCAGAAGCGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196174324 Original CRISPR GATTTTGGCAGAAGCGCTGG TGG Intergenic
No off target data available for this crispr