ID: 1196180110

View in Genome Browser
Species Human (GRCh38)
Location X:112680193-112680215
Sequence GAGCGCGCGCGCATGCGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196180110 Original CRISPR GAGCGCGCGCGCATGCGCGC AGG Intergenic
900345365 1:2207958-2207980 GTGCGCGCGCGCATGCGTGCAGG + Intronic
902501446 1:16914148-16914170 GGGGGCGCGCGCGTGCGCGGGGG + Intronic
903389480 1:22953857-22953879 GTGCGCGCGCGCCTGGCCGCGGG - Exonic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
908014121 1:59814527-59814549 AAGCGAGCGCGCGTGCGCGGCGG - Intergenic
908501103 1:64744889-64744911 GCGCGGGCGCGCCTGTGCGCCGG + Intergenic
909622375 1:77683047-77683069 GTGCGCGCGCACGTGTGCGCGGG - Intronic
914393451 1:147242616-147242638 GGGGGCGCGCGACTGCGCGCTGG - Intronic
915589014 1:156860230-156860252 GAGCTCGCGCCTTTGCGCGCGGG + Intronic
915818781 1:158999084-158999106 GTGTGCGCGCGCACGCACGCAGG - Intergenic
916003127 1:160635349-160635371 GCGCGCGCGCGCATGTACACGGG + Intronic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
923506591 1:234610241-234610263 GAGCGCGCGCGCGGGAGGGCGGG - Intergenic
1068545078 10:58335444-58335466 GGGCCCGCGCGCGTTCGCGCCGG + Intronic
1069419240 10:68231586-68231608 GAGTGCGCGGGCACGTGCGCCGG - Exonic
1069850686 10:71402751-71402773 GCGCGCGCGCACATGCGCGTTGG + Intronic
1069913597 10:71774032-71774054 GTGCGCGCGCGCATGCACTCAGG - Intronic
1073577827 10:104640537-104640559 GCGTGCGCGTGCGTGCGCGCAGG - Intergenic
1075139495 10:119818610-119818632 GATGGAGCGCGCATGCGCACTGG + Intronic
1076707287 10:132308638-132308660 GAGCGCGGGCGCACGTGCTCAGG - Intronic
1076935478 10:133565787-133565809 GTGCCCCCGCGCATGTGCGCTGG + Intronic
1077190801 11:1255310-1255332 GTGCGTGCGTGCATGCGGGCGGG - Intronic
1080678678 11:34452543-34452565 GTGCGTGCGCGCATGCGGGAGGG + Intronic
1083317871 11:61827724-61827746 GGGCGTGCGCGCACGCGCCCCGG + Intronic
1084187567 11:67482958-67482980 GAGCGCGCGCGTCTGCTCGGGGG - Intergenic
1084265727 11:68004199-68004221 GCGCGCGCGCGCGTGTGTGCAGG + Intronic
1085037472 11:73308841-73308863 GAGCGGGCGCGGCTGCGCGGGGG - Exonic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1090155812 11:124437670-124437692 GCGCGCGCGTGCGTGCGTGCTGG + Intergenic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1092989452 12:13881018-13881040 GTGCGCGCACGCATGTGCGCAGG + Intronic
1093435323 12:19129669-19129691 GGGCGCGCGCGGGGGCGCGCCGG + Intergenic
1093728722 12:22544264-22544286 GAGCGCGCGGGGGCGCGCGCGGG + Intronic
1094218499 12:27970325-27970347 GAGCGAGGGCGCAGGCGGGCTGG + Intronic
1094375476 12:29783986-29784008 GAGCGAGCGGGCATGCGCAGTGG - Intronic
1095180863 12:39145230-39145252 GTGGGCGCGCGCTTTCGCGCCGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096254956 12:50057347-50057369 GCGCGCGCGTGTGTGCGCGCAGG - Intergenic
1096482447 12:51951678-51951700 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1103907215 12:124333892-124333914 GTGTGCGCGCGCATGTGTGCGGG + Intronic
1110706261 13:78603706-78603728 GCGCGCGCGCGCAGACGCACGGG - Intergenic
1111183990 13:84705235-84705257 GCGCGCGCGCGCGTGCGTGTTGG + Intergenic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122445437 14:101764029-101764051 GGGCGCGCGCACTTGCGCGTCGG + Intronic
1123487733 15:20756151-20756173 CAGCGCCCGAGCGTGCGCGCGGG - Intergenic
1124696927 15:31870932-31870954 GAGCGGGCTCGCGGGCGCGCGGG - Intergenic
1125171858 15:36774164-36774186 GCGCGCGCGCGCATGCATGAGGG + Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1127415133 15:58749923-58749945 AGGGGCGCGCGCATGCGCGCGGG + Exonic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1132365033 15:101251256-101251278 GGGCGCGCGGCGATGCGCGCGGG - Exonic
1136462136 16:30418155-30418177 GAGCACGCGCGCACGCACACAGG + Exonic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138539852 16:57681374-57681396 GTGCGCGCGTGCGTGCGCGCAGG + Intronic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1142209793 16:88803666-88803688 GACGGGGCGCGCATGCGCGCTGG - Exonic
1142704226 17:1684402-1684424 GTGCGCGCGCGCAGGCGGGTGGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1145963865 17:28903095-28903117 GTGCGCGTGCGGGTGCGCGCCGG + Intergenic
1148781521 17:50124748-50124770 GCGCGCGCGTGCACGCGTGCAGG - Intronic
1148818258 17:50346071-50346093 GCGAGCGCGCGCACGGGCGCGGG - Exonic
1152581187 17:81166236-81166258 GAGCGCGCGCGGAGCGGCGCGGG + Intergenic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1155540397 18:26863454-26863476 GAGCTCGCCCGCCTGCCCGCCGG + Intronic
1161643070 19:5436362-5436384 GCGCGCGCGCGCGTGCGGGGAGG + Intergenic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1162461762 19:10817821-10817843 GCGCGCGCACGCGTGCGTGCCGG + Intronic
1162485962 19:10960847-10960869 GGACGGGCGCGCACGCGCGCCGG + Intergenic
1163850994 19:19663562-19663584 GAGCGCGCGCGGCTGCGGCCCGG + Exonic
1165362759 19:35346785-35346807 GTGTGTGCGCACATGCGCGCAGG - Exonic
1166304192 19:41928391-41928413 GAGCGCGGGCGGGCGCGCGCCGG + Intronic
1166347785 19:42177070-42177092 GGGCGGGCGCGCAGGCGAGCTGG + Intronic
1167018949 19:46860562-46860584 GGGCGAGCGCGCGTGCGCGGGGG - Intergenic
1167134529 19:47608989-47609011 GGGCGCGCGGGCCTGGGCGCGGG + Intronic
1167207174 19:48110502-48110524 GGGCGTGTGCGCATGCGCGGTGG + Exonic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
925370359 2:3340368-3340390 GGGCGGGCGCGCATGCTCCCTGG - Intronic
929788674 2:45009126-45009148 GAGGGCGCGCGCGGGCGGGCGGG - Exonic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
930780799 2:55223636-55223658 GAGGGCGCGCGGAGGCTCGCGGG + Intronic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
933206412 2:79512902-79512924 AAGCGGCCGCGCATGCGCACTGG + Intronic
935137818 2:100322491-100322513 GGACGCGCGCGCAGTCGCGCAGG - Exonic
935237372 2:101150663-101150685 GGGCGCGCGGCGATGCGCGCGGG - Intronic
941309314 2:163909901-163909923 GAGTGCGGGCGCATGGGTGCGGG + Intergenic
942890327 2:180980477-180980499 GAGCGCGCACGGGAGCGCGCGGG + Intronic
944242616 2:197500324-197500346 GGGCGAGCGCGCCTGCGCGCTGG + Exonic
944683637 2:202098818-202098840 GTGCACGCGCGCGCGCGCGCAGG + Intronic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
945319615 2:208406695-208406717 GAGCGCGAGCGCAGCCGCGCGGG + Intronic
946219820 2:218217050-218217072 GAACGCGAGCGCAGGCGCGCCGG - Intergenic
946692432 2:222319542-222319564 GCGGGCGCGGGCAGGCGCGCGGG + Intergenic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
1168750595 20:278913-278935 GAGGGCGCGCGAGTGCGCGGAGG + Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174467865 20:50731430-50731452 GTGCGCGCGCGCGGGCTCGCGGG + Intergenic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176567882 21:8396419-8396441 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176575786 21:8440638-8440660 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1178021871 21:28417468-28417490 GTGCGCGCGCGCAGGTGTGCAGG + Intergenic
1178545683 21:33491467-33491489 GACCGCGCACGCATGCGCAGAGG - Exonic
1179243768 21:39612876-39612898 GAGCGCGCGGCGATGCGCACAGG - Intronic
1180949459 22:19714644-19714666 GCGCGCGCGGGCACGCGGGCAGG - Intronic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
949987861 3:9553826-9553848 GAGAGCGCGCGCCTCGGCGCGGG - Intergenic
950765419 3:15269660-15269682 GTGTGCGCGTGCATGCGCGCTGG - Intronic
951080323 3:18444838-18444860 GAGCGAGCGAGCGAGCGCGCGGG + Intronic
951558860 3:23946027-23946049 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954151836 3:48661802-48661824 GAGCGCATGCGCTTGGGCGCCGG + Exonic
955291119 3:57693068-57693090 GAGCGCGCTTGCCTCCGCGCAGG + Exonic
962793954 3:138834914-138834936 GCGCGCGCGCACACGGGCGCGGG - Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966182221 3:177197632-177197654 GAGCGGGCGGGCGGGCGCGCGGG + Intergenic
968556534 4:1248776-1248798 GTGCGAGTGCGCGTGCGCGCCGG - Intronic
970593188 4:17577179-17577201 GTGCGCCCGCGCATGCGGGCGGG - Exonic
973551301 4:52038322-52038344 GGGCGCAAGCGCAGGCGCGCAGG - Exonic
974069459 4:57110502-57110524 GAGCGCGCGCGCAGGCCCCGCGG - Intergenic
974700860 4:65443939-65443961 GTGCACGCGCACATGCGCACTGG + Intronic
976733274 4:88284835-88284857 GAGGGGGCGCGCTTGCGCGGTGG + Intergenic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977937854 4:102827161-102827183 GGGCGCGCGCGGGAGCGCGCTGG - Intronic
981429602 4:144645086-144645108 GACTGCGCGCGCGTGCGTGCAGG + Intergenic
992286112 5:75236993-75237015 GAGGCCGCGCGCGCGCGCGCAGG + Intergenic
995787105 5:115841912-115841934 GAGCGCGCGCGGTCGCGTGCGGG + Exonic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
1002059815 5:176619745-176619767 GCGCGAGCGTGCATGCACGCTGG - Intergenic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1004069728 6:12287754-12287776 AGGCGCGCGCGCGCGCGCGCAGG + Intergenic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1011640469 6:89412323-89412345 GAGCGCGCGCGCGCCCGTGCGGG - Intergenic
1011698990 6:89937930-89937952 GCACGCGCATGCATGCGCGCAGG - Intronic
1018329953 6:162716747-162716769 GCGCGCGCGCGCAGGCGGGTAGG - Intronic
1019539284 7:1544548-1544570 GAGCGTGGGCGCATGTGAGCGGG - Exonic
1022101199 7:27170022-27170044 GAGCGCGCGCCCCGGCGGGCGGG - Intronic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1026522744 7:71131497-71131519 GTGCGCGCGCGCACCCGGGCAGG - Intergenic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1035127150 7:156616792-156616814 GAGCCCGGGCGCAGGGGCGCGGG - Intergenic
1035747546 8:1973486-1973508 GAGCCCGCGCCCACGCGCGGGGG - Intergenic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1040559854 8:48514599-48514621 CAGCCCGCGCGCATGAGCTCTGG + Intergenic
1042235967 8:66613368-66613390 GAGCGCGCGCGGCTGAGGGCGGG + Intronic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1051418812 9:16870810-16870832 GAGGGCGCGCGCGGGCGGGCGGG - Intronic
1054333334 9:63781656-63781678 GAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1058687231 9:107489607-107489629 GCGCGCGCGGCCATGGGCGCGGG + Exonic
1059107616 9:111525174-111525196 GAGTGCGCGCGCAAGCCTGCGGG - Intronic
1060283375 9:122228492-122228514 GAGCGCGCGCGCGAGCGGGGGGG - Intronic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203470237 Un_GL000220v1:112840-112862 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203478058 Un_GL000220v1:156812-156834 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG + Intronic
1187675770 X:21715310-21715332 ACGCGCGCGCGCTCGCGCGCTGG + Intronic
1188451218 X:30309425-30309447 TAGCGCGCACGCAGGCGCGTCGG + Exonic
1189325190 X:40107412-40107434 GAGCGCGCGCGCTTGGGTGGGGG - Intronic
1189528580 X:41854193-41854215 GCGCGCGCGCGCATGTTCCCTGG - Intronic
1195316845 X:103687501-103687523 GGGCGCGCGCGCGTGCGTGATGG + Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1199984578 X:152941544-152941566 TGGCGAGCGCGCATTCGCGCAGG - Intronic
1200136842 X:153879433-153879455 GTGCACGTGCGCGTGCGCGCAGG + Intronic