ID: 1196183118

View in Genome Browser
Species Human (GRCh38)
Location X:112716850-112716872
Sequence TATCCCAGCCCCATTGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196183114_1196183118 -10 Left 1196183114 X:112716837-112716859 CCCCACCTACATATATCCCAGCC No data
Right 1196183118 X:112716850-112716872 TATCCCAGCCCCATTGTTTATGG No data
1196183110_1196183118 -3 Left 1196183110 X:112716830-112716852 CCCCAACCCCCACCTACATATAT No data
Right 1196183118 X:112716850-112716872 TATCCCAGCCCCATTGTTTATGG No data
1196183111_1196183118 -4 Left 1196183111 X:112716831-112716853 CCCAACCCCCACCTACATATATC No data
Right 1196183118 X:112716850-112716872 TATCCCAGCCCCATTGTTTATGG No data
1196183112_1196183118 -5 Left 1196183112 X:112716832-112716854 CCAACCCCCACCTACATATATCC No data
Right 1196183118 X:112716850-112716872 TATCCCAGCCCCATTGTTTATGG No data
1196183113_1196183118 -9 Left 1196183113 X:112716836-112716858 CCCCCACCTACATATATCCCAGC No data
Right 1196183118 X:112716850-112716872 TATCCCAGCCCCATTGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196183118 Original CRISPR TATCCCAGCCCCATTGTTTA TGG Intergenic
No off target data available for this crispr