ID: 1196185255

View in Genome Browser
Species Human (GRCh38)
Location X:112738625-112738647
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196185255_1196185258 9 Left 1196185255 X:112738625-112738647 CCACTATTCATCTGTGTACACTT No data
Right 1196185258 X:112738657-112738679 TACTAAATGTGAACTCCTCTAGG No data
1196185255_1196185259 14 Left 1196185255 X:112738625-112738647 CCACTATTCATCTGTGTACACTT No data
Right 1196185259 X:112738662-112738684 AATGTGAACTCCTCTAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196185255 Original CRISPR AAGTGTACACAGATGAATAG TGG (reversed) Intergenic
No off target data available for this crispr