ID: 1196189514

View in Genome Browser
Species Human (GRCh38)
Location X:112780136-112780158
Sequence CTGTTGACACAGATTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196189508_1196189514 19 Left 1196189508 X:112780094-112780116 CCACACGTTACCAGGGAGCAAGA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 149
1196189510_1196189514 9 Left 1196189510 X:112780104-112780126 CCAGGGAGCAAGAAAGGATCTGG 0: 1
1: 0
2: 0
3: 17
4: 231
Right 1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 149
1196189507_1196189514 25 Left 1196189507 X:112780088-112780110 CCATTACCACACGTTACCAGGGA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196189514 Original CRISPR CTGTTGACACAGATTGAGTG TGG Intronic
901243883 1:7713124-7713146 CTGACCACACAGAGTGAGTGAGG + Intronic
902822781 1:18953722-18953744 CTGCTGAGACAGGTGGAGTGCGG - Intronic
906003526 1:42447923-42447945 TTGTTGACATGGCTTGAGTGTGG - Intronic
911475695 1:98369467-98369489 CTGTTGTCACTGAGTGACTGTGG - Intergenic
911970255 1:104425887-104425909 GTGTTCACCCAGATTGAGGGTGG - Intergenic
916559449 1:165920917-165920939 CTGTTGCCCCAGCTAGAGTGCGG + Intergenic
916559493 1:165921274-165921296 CTGTTGCCCCAGCTAGAGTGCGG + Intergenic
917130854 1:171741508-171741530 CTGGTGTGACAGATTGGGTGTGG - Intronic
919957489 1:202433455-202433477 CTGTAGGCAAAGATAGAGTGAGG - Intronic
920028963 1:203024590-203024612 CTGTTCACACAGAGTGAGCCTGG + Exonic
921197262 1:212770681-212770703 CTGTTCTCACAGAATGAGTTAGG - Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1074267880 10:111923298-111923320 CTGTTAACACAGACTTTGTGAGG - Intergenic
1074280535 10:112047593-112047615 CTGTGGACAAAGACTGAATGGGG + Intergenic
1074811411 10:117108790-117108812 AAGTTGACACTGATGGAGTGAGG + Intronic
1076701228 10:132274316-132274338 CTGTTGACCCACATTTGGTGTGG - Intronic
1076743877 10:132503042-132503064 CTCTTGACACAGCTTTACTGAGG - Intergenic
1077006369 11:359446-359468 CTGATGACACAGATCAAGTGAGG - Intergenic
1083840018 11:65299086-65299108 CTGGTGACACAGCTGAAGTGGGG - Intronic
1086859555 11:91909083-91909105 CTGTAGCCACAGAATAAGTGGGG - Intergenic
1087657975 11:100949250-100949272 CTGGTAACACAGTTTGAGGGAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090854041 11:130596498-130596520 CAGTTGACACAGCCTGAGTGAGG - Intergenic
1093065846 12:14657218-14657240 CTGATGACATAGAAGGAGTGAGG + Intronic
1093519968 12:20037611-20037633 CTGTGGACAAATATTGATTGTGG - Intergenic
1095735558 12:45552832-45552854 CTGTTGCCCCTCATTGAGTGAGG - Intergenic
1096480713 12:51939045-51939067 CTGGTTACACAGAATGAGTTGGG - Intergenic
1103673445 12:122637121-122637143 CTGTTGCCCCGGATGGAGTGTGG - Intergenic
1103841385 12:123868075-123868097 CTGTTGACACAGAAGGAGTTTGG + Exonic
1106080209 13:26494050-26494072 CTGATGAGAGAGTTTGAGTGTGG - Intergenic
1107022347 13:35764736-35764758 CTGATGAAACATATTGAGAGAGG + Intergenic
1107464804 13:40639706-40639728 TTGTTGTCACAGCTTGGGTGGGG - Intronic
1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG + Intergenic
1111024564 13:82502538-82502560 ATGTGGACACACAATGAGTGAGG + Intergenic
1114194923 14:20469069-20469091 CTATTGACACAGCTGGAATGAGG + Intronic
1120226598 14:81797466-81797488 CTGCTGATACAGATTCATTGAGG + Intergenic
1124169198 15:27357686-27357708 ATGTTGCAACAGATTGAATGCGG - Intronic
1124996192 15:34725112-34725134 CTGTTGATCCAGAGTGAGTCTGG - Intergenic
1129002863 15:72348314-72348336 CTGTTGACACAGGCTGAGAAAGG + Intronic
1129362801 15:75034757-75034779 GTCTTGTCACAGATTAAGTGCGG + Intronic
1130366693 15:83247094-83247116 CTGGTGTCACAGAATGAGTTAGG + Intergenic
1133059473 16:3165109-3165131 ATGGGGACACAGATTGAGTTGGG - Intergenic
1133098618 16:3465443-3465465 CTTCTGACACTGACTGAGTGGGG + Intronic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1137947881 16:52751668-52751690 CTATTGACACAGTTTAGGTGAGG - Intergenic
1138211965 16:55171015-55171037 CTGTTCTAACAGATTGAGAGAGG + Intergenic
1138326694 16:56178080-56178102 CTGGTGACATAGATTAAGTTGGG + Intergenic
1143360424 17:6364808-6364830 CTGGTGTCACACAGTGAGTGAGG - Intergenic
1148385313 17:47230199-47230221 CTGTGGACTGAGGTTGAGTGGGG - Intergenic
1148897187 17:50845785-50845807 CTCCTGACACAGCCTGAGTGAGG - Intergenic
1149491700 17:57089794-57089816 GTTTTGAAACAGTTTGAGTGAGG + Intronic
1165805417 19:38577873-38577895 GTGTAGACACAGCTGGAGTGTGG - Intronic
1166859010 19:45798886-45798908 GGGTGGACACAGATTGGGTGGGG + Intronic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167136746 19:47620941-47620963 CCGTAGACAGAGATCGAGTGGGG - Intronic
925092283 2:1165333-1165355 TTGTTTACGCAGATAGAGTGTGG + Intronic
926233505 2:11022451-11022473 CTGTTGTAACAGACTGAATGAGG + Intergenic
927033443 2:19147295-19147317 CTGATGACAAAGAATGACTGGGG - Intergenic
929106760 2:38372905-38372927 CTGTGGACAGAGATTTAGTTTGG - Intronic
930453882 2:51581109-51581131 CTGTATAGAGAGATTGAGTGTGG - Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
931743176 2:65267234-65267256 CTGTTGTCACATATTGTCTGTGG + Intronic
933588159 2:84202127-84202149 CTCTTGACACACATTGAGAATGG + Intergenic
934958003 2:98641004-98641026 GTGTTGACAGAGATTGTCTGTGG - Intronic
935585390 2:104796219-104796241 CTGTTTACAGAGGTGGAGTGAGG + Intergenic
936827460 2:116599753-116599775 CTGTGGACCCAAATGGAGTGAGG - Intergenic
937228346 2:120382592-120382614 GTGATGACACAGCTTGAGTGGGG - Intergenic
937665099 2:124477784-124477806 CTGCTGACACAGATTGTGATTGG + Intronic
938709603 2:133964841-133964863 TTGAGGACACAGATTGAATGAGG + Intergenic
938856048 2:135312233-135312255 CTGTTGCCAAAGCTGGAGTGCGG + Intronic
939785922 2:146512411-146512433 CTGATTACATAAATTGAGTGAGG - Intergenic
940225163 2:151393471-151393493 CTGTTGCCCCGGCTTGAGTGTGG - Intergenic
942379439 2:175373332-175373354 CTGATTACACAGATTGACTAAGG - Intergenic
944931965 2:204529139-204529161 CTGTGGCCACAGATTCTGTGGGG + Intergenic
946175142 2:217917971-217917993 CGGCTGAAACAGAATGAGTGAGG + Intronic
947845189 2:233238022-233238044 ATGTGGACACAGCTTGAATGTGG + Intronic
948410695 2:237757828-237757850 TTGTTGAAACAGCTGGAGTGAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1173395128 20:42672199-42672221 GTGTTCACCCAGATTGAGGGTGG - Intronic
1173638156 20:44579196-44579218 CTGATGACACATATTTAGTTGGG - Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1175887432 20:62300457-62300479 CTGTGGCCACAGAGTGGGTGGGG - Intergenic
1177031591 21:15986640-15986662 ATATTGACAGAGATTGACTGTGG - Intergenic
1177469005 21:21531378-21531400 CAGGTAACACTGATTGAGTGTGG + Intronic
1178307815 21:31505058-31505080 CTTAGGACACAGAATGAGTGAGG + Intronic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1180734206 22:18003507-18003529 TGGTTGTCACAGATTGAGTTAGG - Intronic
1183960320 22:41407706-41407728 CTGTTGACACGGCTGGAGTGTGG + Intergenic
949209866 3:1484906-1484928 CTGTTGAAACAGATTCCCTGTGG - Intergenic
949783138 3:7712305-7712327 CTGTTAACATAGGTTGGGTGGGG + Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950420362 3:12895258-12895280 CTGTTGGCAAAGCTGGAGTGTGG - Intergenic
951921564 3:27860244-27860266 CAGTTAACGTAGATTGAGTGTGG - Intergenic
955612241 3:60769962-60769984 CTTTTTACTCAGTTTGAGTGGGG - Intronic
956185354 3:66557216-66557238 CTGTTGCCTGAGATTGAGAGTGG + Intergenic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
967485761 3:190028469-190028491 CTGTTGACACACAATTAGAGGGG + Intronic
970622554 4:17839098-17839120 CTGTTGACATAGTTTAATTGGGG + Intronic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
977026408 4:91823706-91823728 GTGTTCACCCAGATTGAGGGTGG + Intergenic
977662025 4:99600005-99600027 CTGTTCACACATATTCATTGTGG + Intronic
977997124 4:103508066-103508088 TTCTTGTCACAGATTGAGTGGGG - Intergenic
978617720 4:110612834-110612856 CTGTTGACACAGGCAGAGCGGGG + Intergenic
982770936 4:159396705-159396727 GTGTTGACCCAGATTAAGAGTGG - Intergenic
982891511 4:160858132-160858154 GTGTCCACCCAGATTGAGTGTGG - Intergenic
985386754 4:189455207-189455229 ATGCTGAGACAGATTGACTGGGG - Intergenic
985544177 5:500865-500887 GTGTGGACACAGAGTCAGTGTGG + Intronic
988931077 5:36035975-36035997 CTGTTGAGAGAGATAGAGAGGGG + Intronic
990973422 5:61535135-61535157 CTGATGCCACACATTGAGAGAGG + Intronic
991654837 5:68893738-68893760 CTGACCACACAGATTGAGTGAGG - Intergenic
994205981 5:97035885-97035907 ATGTTGATTCAGATTGAATGAGG + Exonic
995086121 5:108111905-108111927 CTGTTGACACACATTGAACAAGG + Intronic
999351689 5:150877287-150877309 GTGCTCACCCAGATTGAGTGTGG - Intronic
999784247 5:154877169-154877191 CTGTTGACACAAAATATGTGGGG + Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1003518225 6:6835286-6835308 CTATAGATACAGATAGAGTGGGG - Intergenic
1003545450 6:7054197-7054219 CTGTTGCCTCAGCTGGAGTGCGG - Intergenic
1003737529 6:8893573-8893595 CTTTTGAGTCAGATGGAGTGAGG + Intergenic
1007435293 6:41806249-41806271 CTGGCGACGCAGCTTGAGTGTGG + Exonic
1014384031 6:120779442-120779464 CTGTGGCCTCAGCTTGAGTGGGG - Intergenic
1016017472 6:139200719-139200741 CTGTTAACAAAGATTTATTGAGG + Intergenic
1016536890 6:145116954-145116976 CTGTTGACAGATATTCCGTGTGG - Intergenic
1017049758 6:150379331-150379353 CTGTAGACATAGCTTGACTGGGG - Intronic
1018039740 6:159911369-159911391 CTGTTGCCCCAGCTGGAGTGCGG + Exonic
1018177449 6:161189454-161189476 CTGTAGCCACACAGTGAGTGAGG + Intronic
1018479064 6:164171817-164171839 GTGCTCACCCAGATTGAGTGTGG - Intergenic
1020376437 7:7492546-7492568 CTGTTGCCAAAGCTGGAGTGTGG - Intronic
1020677617 7:11199733-11199755 CTGTTGACACAGATACTATGTGG - Intergenic
1022560832 7:31347230-31347252 CTGTGGCCCCAGGTTGAGTGGGG + Intergenic
1028541855 7:91951359-91951381 CTGTTGCCCCAGCTGGAGTGTGG + Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1036749517 8:11435034-11435056 GAGTGGAGACAGATTGAGTGAGG - Exonic
1039540004 8:38358424-38358446 CTATGGAAACACATTGAGTGTGG - Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040658945 8:49546239-49546261 GTGATGGCAAAGATTGAGTGTGG + Intronic
1042751940 8:72167185-72167207 CTGGTCACACAGAATGAGTTAGG + Intergenic
1042776352 8:72436265-72436287 GTGTTGACACAGCTTGGGTATGG - Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG + Intergenic
1052618210 9:30871029-30871051 CTGTTGAGACACATAAAGTGAGG - Intergenic
1054343426 9:63890374-63890396 CTGTGGACTCAGATTGAGCCAGG - Intergenic
1058641429 9:107089090-107089112 GTGTTAACAGAGATTTAGTGGGG + Intergenic
1059393099 9:114011941-114011963 CTGTTGAAACAGAGTAAGTCTGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060330452 9:122664049-122664071 GTGTTAACTCAGATTGAGGGTGG + Intergenic
1062103734 9:134741524-134741546 CTGTTGATGCAGATTCACTGGGG + Intronic
1062514920 9:136928236-136928258 TTGTTAAAACAGATTGATTGAGG + Intronic
1203772416 EBV:56313-56335 CTGTTGACAGCGATAGAGTATGG - Intergenic
1186116351 X:6308623-6308645 GTGTCCACACAGATTGAGGGTGG - Intergenic
1187533569 X:20117379-20117401 CTGTGTTCACACATTGAGTGAGG - Intergenic
1190827660 X:54032389-54032411 CTATTGGAACAGAGTGAGTGAGG - Intronic
1191226134 X:58045049-58045071 GTGTCCACACAGATTGAGGGTGG - Intergenic
1192534389 X:71914849-71914871 CTCTTGAGTCAGATGGAGTGGGG + Intergenic
1192836211 X:74802170-74802192 CTTTTGCCACATATTGATTGTGG + Intronic
1193356729 X:80527857-80527879 GTGTCCACCCAGATTGAGTGTGG - Intergenic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1201514100 Y:14798710-14798732 CTGTTGAGAGAGATAGAGTTTGG + Intronic
1201684895 Y:16690204-16690226 CTGTGGACACACAAGGAGTGAGG - Intergenic