ID: 1196190618

View in Genome Browser
Species Human (GRCh38)
Location X:112790647-112790669
Sequence GTGGGAGCAGAAATATTTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196190618_1196190624 28 Left 1196190618 X:112790647-112790669 CCTCCAAATATTTCTGCTCCCAC 0: 1
1: 1
2: 3
3: 18
4: 243
Right 1196190624 X:112790698-112790720 TCCTCTCCTCTTTCTCCCGAAGG 0: 1
1: 0
2: 6
3: 45
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196190618 Original CRISPR GTGGGAGCAGAAATATTTGG AGG (reversed) Exonic
900609055 1:3536795-3536817 GGGGGAGCAGTGACATTTGGGGG - Intronic
903460741 1:23518993-23519015 GTGAGAGGGGAAATATTTGGTGG - Intronic
904313193 1:29642508-29642530 GAGGCAACAAAAATATTTGGTGG + Intergenic
904390525 1:30182675-30182697 GGGGTGGCAGAAATATTGGGTGG - Intergenic
904483700 1:30810151-30810173 GGTGGAGCAGGAATATTTTGTGG - Intergenic
906087894 1:43151653-43151675 GAGAGAGGAGAGATATTTGGTGG + Intronic
908465656 1:64391136-64391158 GTAACAGCAGAAATATTTGCTGG + Intergenic
911285166 1:95982765-95982787 ATCTGAGCAGAAATATCTGGAGG + Intergenic
911354348 1:96797847-96797869 CTTGGATCAAAAATATTTGGGGG - Intronic
913422987 1:118693772-118693794 GTGGGAGCTAAAATAAATGGTGG - Intergenic
914798753 1:150943884-150943906 GTGACAGCAGAAAGATCTGGGGG - Intronic
917429351 1:174949537-174949559 GTGGGAGAAGAACAAATTGGGGG + Intronic
918922211 1:190727532-190727554 GTGGGAGCAGAAACCTCTGTGGG - Intergenic
919023254 1:192135769-192135791 GAGGGAGAAGAAATCCTTGGTGG + Intergenic
920118977 1:203641395-203641417 GTGGGAGCAGACATTTCTAGAGG + Intronic
921598932 1:217086715-217086737 GTGGGAATAGAAAGATTTTGAGG - Intronic
922348370 1:224715963-224715985 TTGGGAGGAGAAATATTTTTAGG - Intronic
922653653 1:227362472-227362494 GTGAGAGCCGTAAGATTTGGGGG + Intergenic
923227914 1:231956468-231956490 GTGGAAGCAGAAAGACATGGAGG - Intronic
923982279 1:239338615-239338637 GCAAGAGCAGAAATATGTGGGGG - Intergenic
1064581689 10:16799403-16799425 GTAGGAGCAGAAATACCTGCTGG + Intronic
1066044796 10:31585638-31585660 GAGGGAGCAGAAAAGTTTGTGGG + Intergenic
1066162728 10:32751424-32751446 TTGGAAGCATGAATATTTGGTGG + Intronic
1067729915 10:48803226-48803248 GTGGGAGAAGAATGATTTGCAGG - Intronic
1069589520 10:69633114-69633136 GTGAGAGCAGGCATATTTGGAGG + Exonic
1069898166 10:71691739-71691761 AAGGGAGCAGGAATCTTTGGTGG + Intronic
1070173464 10:73950473-73950495 TTGGGACCAGCAATATTTAGAGG + Intergenic
1072505233 10:96059589-96059611 GTGGGAGAAGAAAGATTTGGTGG + Intronic
1074669440 10:115772876-115772898 CTGTGAGCAGAGAAATTTGGGGG + Intronic
1079835392 11:25327342-25327364 GCGGCAGCAAAAATTTTTGGGGG + Intergenic
1080210611 11:29781049-29781071 GTGGGAGAAGAAGGCTTTGGTGG - Intergenic
1082106551 11:48227742-48227764 GTGGGAGCAGAAAGATCCAGGGG - Intergenic
1082640647 11:55655895-55655917 GTGGGAGTAGAAGTATTTCTTGG - Intergenic
1082657008 11:55868649-55868671 CTGGCAGCAGAAATAGTTTGCGG - Intergenic
1082907755 11:58329808-58329830 TTGGGAGCACATATATTTAGGGG + Intergenic
1084355970 11:68638918-68638940 GGGGCAGCAAAAATTTTTGGGGG - Intergenic
1087151016 11:94859638-94859660 GTGGGAGCAGAAGTACCTGGAGG + Exonic
1087982592 11:104634449-104634471 GAGGGAGGAGGAATATTTGAAGG + Intergenic
1089332503 11:117699709-117699731 GATGGAGCAGAAGTAGTTGGGGG - Intronic
1090637219 11:128697035-128697057 TTGGGAGAAGCAATATTTGCTGG + Intronic
1093302841 12:17476518-17476540 GTGGGAGCTGGAATATTAGTGGG - Intergenic
1093768043 12:22987417-22987439 GTTAAAGCAGAAATCTTTGGGGG - Intergenic
1098639963 12:72826307-72826329 GGGGCAGCAGAAATTTTTGTGGG - Intergenic
1098942382 12:76552469-76552491 GAGGGAGCACAAATTTTTGTGGG + Intronic
1100441704 12:94623487-94623509 GTGAGAGCAGAAATAAGTGCTGG - Intronic
1100641692 12:96488218-96488240 GAAGAACCAGAAATATTTGGTGG - Intergenic
1101239824 12:102826928-102826950 GAGGGGGAATAAATATTTGGTGG - Intergenic
1101476979 12:105060180-105060202 GTAGGAGAAAAAAGATTTGGGGG + Intronic
1101790921 12:107927059-107927081 GTTGGTGCAAAAATATTTGCAGG - Intergenic
1101825633 12:108218138-108218160 ATGGGGGCATAAATATTGGGTGG - Intronic
1102714425 12:114957544-114957566 GTGGGAGAAGCAGTGTTTGGAGG - Intergenic
1104711544 12:130990384-130990406 GTGGGATTAGAAATAGTTGGGGG + Intronic
1105567877 13:21569324-21569346 GTGGGAGTTGAAAGGTTTGGGGG - Intronic
1107075997 13:36321664-36321686 GGGGCAGCAAAAATTTTTGGGGG - Intronic
1107709051 13:43134546-43134568 GTGCCAGCAGATACATTTGGTGG + Intergenic
1111750704 13:92328274-92328296 ATGGCAACAGAAATATCTGGAGG + Intronic
1113333816 13:109358321-109358343 GAGTGAGCAGACATTTTTGGGGG + Intergenic
1115371931 14:32626031-32626053 GTGGAAGCACTAACATTTGGTGG + Intronic
1115760557 14:36576752-36576774 GTGGGAGTAGTAGTATCTGGTGG + Intergenic
1116637569 14:47416846-47416868 GTGGGAGCAGAATGATTTCATGG - Intronic
1116891136 14:50269715-50269737 GGGGGAGCAAAAAAAATTGGTGG - Intronic
1117026484 14:51625611-51625633 TCGGGAGCAGAAAGATTTGAAGG - Intronic
1117155233 14:52933062-52933084 GTGGGGGCAGAAGTATAGGGAGG - Intronic
1119667745 14:76497223-76497245 CAGGGAGCAGAAAAATGTGGAGG + Intronic
1119963476 14:78886163-78886185 AAAGGAGCACAAATATTTGGTGG + Intronic
1120394864 14:83956168-83956190 GTGGGACTAGAAATGTATGGGGG - Intergenic
1121798719 14:96755973-96755995 GGGGGAGCAGAAATCTGAGGGGG + Intergenic
1122267494 14:100553542-100553564 GTGGGGGCAGCCACATTTGGGGG - Intronic
1124004638 15:25785985-25786007 ATGGAGACAGAAATATTTGGGGG + Intronic
1124382306 15:29177049-29177071 GTGGGAGAAGGAAGAGTTGGAGG + Intronic
1124559512 15:30758657-30758679 GTTAGACCAGACATATTTGGGGG + Intronic
1125970466 15:43907201-43907223 GAGGGAGGAGAAATATTAAGAGG + Intronic
1132104937 15:99056715-99056737 GTGGGAGCACAAAGATTTTAAGG + Intergenic
1133714200 16:8431192-8431214 CTGGGAGAATAAATATTTTGGGG - Intergenic
1134285484 16:12858193-12858215 TTGTAAGCAAAAATATTTGGAGG - Intergenic
1134522589 16:14925419-14925441 GTGGGAACAGACGTATGTGGGGG - Intronic
1134550040 16:15134637-15134659 GTGGGAACAGACGTATGTGGGGG + Intronic
1134718429 16:16368358-16368380 GTGGGAACAGACGTATGTGGGGG - Intergenic
1134780196 16:16888403-16888425 GTGGGAGGAGAAGAAGTTGGAGG + Intergenic
1135891417 16:26360689-26360711 GTGGCTGCAAACATATTTGGAGG - Intergenic
1137270896 16:46901711-46901733 GACGGAGCAGAAAAAGTTGGCGG - Intronic
1137712806 16:50578375-50578397 GAGGAAGTAGGAATATTTGGGGG + Intronic
1138191350 16:55016587-55016609 ATGGGAGCTGAAATAAATGGTGG + Intergenic
1141010196 16:80389653-80389675 GTGGAAACAGAAAGCTTTGGGGG - Intergenic
1141985452 16:87576892-87576914 CTGGGTGCAGAAAGCTTTGGTGG + Intergenic
1143888432 17:10084229-10084251 GTGGGGGCAGGAATTTTTAGGGG + Intronic
1144271073 17:13616655-13616677 CTGGGAGAAGAAAACTTTGGGGG - Intergenic
1144384115 17:14732922-14732944 GAGGGAGCAGAATAATTTGGGGG + Intergenic
1144755155 17:17675589-17675611 GGGGGAGCAGCAACAGTTGGTGG + Intergenic
1144954858 17:19013947-19013969 GTGGGTGGAGAAATGTTTTGGGG + Intronic
1146964308 17:37011836-37011858 ATGGAAGCAGAAATATTAGGTGG + Intronic
1148729936 17:49827884-49827906 GTGGTGGCAGCCATATTTGGAGG - Exonic
1149049192 17:52284677-52284699 AGAGAAGCAGAAATATTTGGAGG + Intergenic
1149221144 17:54416319-54416341 GGGGCAGCAAAAATTTTTGGGGG - Intergenic
1151150323 17:72079594-72079616 CTGGGAGAAGAAGTACTTGGAGG + Intergenic
1159348918 18:67245334-67245356 GAGTAAGCAGAAATATTAGGAGG + Intergenic
1159550705 18:69893717-69893739 GTGGTTGGTGAAATATTTGGGGG - Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160258055 18:77264422-77264444 GTGGGAGAAGAAAAGTTGGGGGG - Intronic
1160526626 18:79542393-79542415 GTGGGTGCATAAATAATCGGTGG - Intergenic
1162226823 19:9229712-9229734 AAGGGAGCTGAATTATTTGGAGG + Intergenic
1166287161 19:41838326-41838348 GTGGGTGCAGAAAGAGCTGGGGG - Intronic
1166819819 19:45570961-45570983 GTGACAGCAAAACTATTTGGGGG + Intronic
1167643156 19:50693085-50693107 GAGGGGGCAGAAATAGGTGGAGG - Intronic
1168298337 19:55388811-55388833 GTGGGTGCAGCCACATTTGGAGG + Intronic
925090060 2:1148166-1148188 GTGAGAGCAGAAACATTGTGAGG + Intronic
925333324 2:3075319-3075341 GTGGGAGCAGAGAGATGGGGTGG + Intergenic
929064151 2:37956177-37956199 GTGAAAGCCCAAATATTTGGTGG - Intronic
931688114 2:64811999-64812021 GCAGGAACAGATATATTTGGGGG - Intergenic
932344980 2:70989380-70989402 GTGGGAGAAGAAAACCTTGGCGG + Intronic
932358564 2:71086863-71086885 GGGGCAGCAAAAATTTTTGGGGG + Intergenic
933507811 2:83201195-83201217 GTAGGTGAAGAAATATTTGCTGG - Intergenic
934141668 2:89053108-89053130 GTGGGAGCTGGAATATTAGCGGG - Intergenic
934227575 2:90147438-90147460 GTGGGAGCTGGAATATTAGCGGG + Intergenic
936022004 2:109002141-109002163 GCAGGAGCAGAAAGAGTTGGGGG - Intergenic
937422491 2:121769976-121769998 GTAGGAGCAGGGATATTTTGGGG - Intergenic
937799675 2:126068308-126068330 GTGGGTGCAAAAATAATTGCTGG + Intergenic
939640964 2:144639338-144639360 GGGGCATGAGAAATATTTGGGGG - Intergenic
944387924 2:199185154-199185176 GGGGCAGCAAAAATTTTTGGGGG - Intergenic
946957531 2:224948077-224948099 GGTGAAGCAGAAATATTTGGAGG + Intronic
947066002 2:226226207-226226229 GTGGGAGCAGAAGGAGTTGAAGG - Intergenic
1173314675 20:41932614-41932636 GTGCGAGCCGAAAGCTTTGGTGG + Intergenic
1175607201 20:60320884-60320906 GTTGGAGCAGAAAGAGATGGTGG + Intergenic
1179390627 21:40986990-40987012 GGGGCAGAAGAAATATTTGAAGG + Intergenic
1181084481 22:20433130-20433152 GTGTGAGCACAAAGGTTTGGAGG + Intronic
1181968172 22:26671188-26671210 AGGGGAGCTGAAATATTTGCAGG + Intergenic
1182317798 22:29459548-29459570 CTGTGTGCATAAATATTTGGGGG - Intergenic
1182511129 22:30821307-30821329 GTGGGAGCAGAGAGACTTGCAGG + Intronic
1184449308 22:44573595-44573617 ATGGGTGCAGAAATAATAGGAGG - Intergenic
1203289217 22_KI270735v1_random:17653-17675 GCGGGGGCAAAAATACTTGGCGG + Intergenic
950874710 3:16261334-16261356 TTGGAAGCAGAGATTTTTGGTGG - Intronic
951223680 3:20096116-20096138 GTGGGAGGAGATGTAGTTGGAGG + Intronic
951314433 3:21171299-21171321 GTGGGACCCCAAATCTTTGGTGG - Intergenic
951808036 3:26668346-26668368 GCAGGATCAGAAAGATTTGGGGG + Intronic
952474981 3:33699289-33699311 AAGGTAGAAGAAATATTTGGAGG + Intronic
953030386 3:39176079-39176101 GTGGGAGGAGCAAGATTTTGGGG - Intergenic
955605436 3:60696901-60696923 GTGGGAGAACAAACATTTTGAGG + Intronic
955795676 3:62634011-62634033 GTGGGAAGTGAAATATTTTGGGG + Intronic
957451989 3:80390997-80391019 GAGGCAGCAAAAATTTTTGGGGG - Intergenic
958024309 3:88032881-88032903 ATGGAAGCAGAAATATATGGGGG + Intergenic
958464901 3:94445225-94445247 TTGGGTGCATATATATTTGGTGG - Intergenic
959484720 3:106913560-106913582 TTGAGAGCAGAAATATTTCAAGG - Intergenic
960241364 3:115345920-115345942 ATGGGACCACACATATTTGGAGG - Intergenic
961928138 3:130504926-130504948 GGTGGAGCACAAATCTTTGGTGG + Intergenic
962316076 3:134360263-134360285 GTGGGAGCAGAAGTATTTGGAGG - Exonic
964336641 3:155661566-155661588 TTTGAAGCAGAAATGTTTGGGGG + Intronic
966402291 3:179560676-179560698 TTGGAAGAAGAAATATTTTGGGG + Intergenic
968638047 4:1692738-1692760 GTGAGAGCTGACATGTTTGGAGG - Intergenic
969451725 4:7277675-7277697 CTGGGAGCAAAATAATTTGGGGG + Intronic
971465667 4:26957266-26957288 GTGGGATTGAAAATATTTGGGGG - Intronic
971697579 4:29926237-29926259 GTGGGTGCAAAATTAATTGGGGG + Intergenic
972407683 4:38762340-38762362 GTGGAAGGAGGATTATTTGGGGG + Intergenic
973142963 4:46792003-46792025 GTGATAGCTGAAATATTTAGAGG - Intronic
974069023 4:57107507-57107529 GTGTCAGAAGAAATATTTAGGGG + Intronic
977636171 4:99300962-99300984 GAGGGAGCGGAAATACTTGCTGG + Intergenic
978508253 4:109484548-109484570 GAGAGATCAGAAAGATTTGGTGG + Intronic
978840862 4:113209970-113209992 GTGCCAGCAGATCTATTTGGTGG + Intronic
979166297 4:117535912-117535934 GTGTGATCAGAAAGATTTAGGGG - Intergenic
979503056 4:121461712-121461734 ACAGGAGCAGAAATATCTGGAGG + Intergenic
980397232 4:132230116-132230138 GTTGTAGCAGATACATTTGGTGG + Intergenic
982887917 4:160806814-160806836 ATGGAATCAGAAATATTTTGGGG + Intergenic
983043004 4:162953034-162953056 GTGGGAGTAGATATTTTAGGTGG - Intergenic
983657182 4:170094729-170094751 TTGGGAACAGAAGTATTTGGGGG + Intergenic
986201475 5:5583172-5583194 GTGGAAATAGGAATATTTGGAGG + Intergenic
988866324 5:35338974-35338996 GAGGAAGCAGATATCTTTGGGGG - Intergenic
988921116 5:35943516-35943538 GTCAGAGAAGAAATCTTTGGTGG - Intergenic
990564631 5:57016962-57016984 GGGGAAGCAAAAATTTTTGGGGG + Intergenic
992228884 5:74644025-74644047 AGGGGAGCACAAATCTTTGGTGG - Intronic
993562516 5:89428431-89428453 GTGTGGACATAAATATTTGGGGG + Intergenic
995747615 5:115420029-115420051 GTGTGAGCAGAAATGTTAGCTGG - Intergenic
995940697 5:117579509-117579531 ATGCATGCAGAAATATTTGGAGG + Intergenic
995967595 5:117927724-117927746 AAGGGAACAGAAATATTCGGGGG + Intergenic
997432536 5:133850676-133850698 ATGGAGGCAGAAATGTTTGGTGG + Intergenic
997772233 5:136565834-136565856 GAGGCAGCAAAAATTTTTGGGGG + Intergenic
999107323 5:149085332-149085354 GTGGGGGCAGAAATATGAGGAGG - Intergenic
1000745132 5:165023505-165023527 GAGGAAGCAGAAATTCTTGGGGG - Intergenic
1005818426 6:29576613-29576635 AGGGAACCAGAAATATTTGGTGG + Intronic
1006237093 6:32643039-32643061 GTGAGAGGAGAAATATTTGGAGG - Exonic
1006247073 6:32746669-32746691 GTGAGAGAAGAAACATTTGGAGG - Exonic
1006865433 6:37205833-37205855 GTTGCTGAAGAAATATTTGGTGG + Intergenic
1007096875 6:39218721-39218743 GAAGGAGCAGAAGTATTTGCAGG - Intronic
1008542680 6:52558895-52558917 GTGTGAGGAAAAATATTTGTTGG - Intronic
1008830748 6:55758122-55758144 ATGGGAGTGGAATTATTTGGTGG - Intronic
1009480481 6:64151762-64151784 GTAGAAGCAGTAATATTTGGAGG + Intronic
1010424402 6:75711012-75711034 ATCAGAGCAGTAATATTTGGTGG + Intronic
1014481589 6:121945483-121945505 GTGGGAGCTGAACTATGAGGAGG - Intergenic
1014909500 6:127073715-127073737 GTGGGAGCAATAATTTTTGTAGG - Intergenic
1015352589 6:132239432-132239454 GGTGGAGGAGAAATATTTGAAGG + Intergenic
1016339007 6:143040873-143040895 GAGTGAGCTGAAATATTTGCAGG - Intergenic
1016780343 6:147950895-147950917 GTGGGAAGAGAAAGATGTGGAGG - Intergenic
1017033976 6:150250804-150250826 GTGGGAGCAGAGGCCTTTGGAGG - Intergenic
1017959060 6:159206145-159206167 CTGGCTGCAGAAATATCTGGTGG - Intronic
1018403812 6:163455470-163455492 TTGGGAAGAGATATATTTGGTGG + Intronic
1018729238 6:166636520-166636542 GGAGGAGGAGAAATATGTGGAGG - Intronic
1020471884 7:8546906-8546928 GTGGCACCAGAAGTATTTGAGGG - Intronic
1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG + Intergenic
1023758230 7:43440009-43440031 GTGGAAGCAGAAGGCTTTGGAGG - Intronic
1024512230 7:50213122-50213144 GTGAGAGCAGAAGTATTGGAAGG - Intergenic
1025112175 7:56227275-56227297 GTGGGGGAAGAAAGATTTGTTGG - Intergenic
1025618768 7:63148760-63148782 CTGGGAGCTGATATATCTGGAGG + Intergenic
1026125791 7:67578464-67578486 ATGGCAGCTGAAATATTTTGAGG + Intergenic
1027841288 7:83315131-83315153 ATGGGGTTAGAAATATTTGGAGG + Intergenic
1027928482 7:84499166-84499188 GGGGAAGTAGAAATATTTGGAGG + Intergenic
1028979012 7:96946065-96946087 GTGGAAACAGAAAGCTTTGGAGG - Intergenic
1029317706 7:99729433-99729455 GGGGCAGCAAAAATTTTTGGGGG - Intronic
1031907273 7:127474611-127474633 GTGTGAGCAAAACTATTTGAGGG + Intergenic
1034909825 7:154986616-154986638 TTGGGAGCACTAATATTTTGTGG - Intronic
1035603531 8:913871-913893 GTGGGAGCCGAAAGATGGGGAGG + Intergenic
1035641617 8:1188874-1188896 GTGGCATCATATATATTTGGAGG - Intergenic
1036282160 8:7409553-7409575 GTGGGAGCAGGAATATCACGTGG - Intergenic
1036339308 8:7902018-7902040 GTGGGAGCAGGAATATCACGTGG + Intergenic
1037658651 8:20908539-20908561 GTGGGAGCACAAGTATTTGGTGG + Intergenic
1038626661 8:29200561-29200583 GTGATATAAGAAATATTTGGTGG - Intronic
1039170256 8:34737097-34737119 GTTGCATAAGAAATATTTGGAGG + Intergenic
1039414855 8:37385237-37385259 TTGGGAGGAGATATTTTTGGTGG + Intergenic
1039437412 8:37569592-37569614 GGGGGAGCATGAATCTTTGGTGG - Intergenic
1039726155 8:40218833-40218855 GAAGGAGCCGAAATATTTGAGGG - Intergenic
1041683737 8:60622751-60622773 GTGGGAGGAGTTATATTTGAGGG - Exonic
1044547669 8:93477581-93477603 GTGGGTGGAGAAAGTTTTGGGGG - Intergenic
1045126562 8:99097146-99097168 GTGGGAGCACAAATTATTGATGG + Intronic
1045287708 8:100806274-100806296 GTAGGAGCAGAAATGTTGGCAGG - Intergenic
1047403573 8:124566497-124566519 ATGGGAAGAGACATATTTGGGGG - Intronic
1048968669 8:139631624-139631646 GTGGGAGAGGAATTATTTAGTGG - Intronic
1049624419 8:143613651-143613673 GTGGGAGCAGGAATATTCATGGG - Intronic
1050140836 9:2514246-2514268 GTGGGGGCTGAAATATTAGTGGG - Intergenic
1050315829 9:4399950-4399972 GTTGGAGCAGAAATAGGAGGTGG + Intergenic
1050423430 9:5490428-5490450 GTGGGAGGGCAAATATTTGGAGG - Intergenic
1050793065 9:9498610-9498632 GTGTAAGGAGAAATATTTTGAGG + Intronic
1051253826 9:15191376-15191398 GTGGTAACAGAAATATCTGGTGG - Intronic
1051413661 9:16816490-16816512 AAGGCAGCAGAAAAATTTGGAGG - Intronic
1053116223 9:35505383-35505405 GGAGGAGTAGAAATATGTGGTGG - Intronic
1053184599 9:36004660-36004682 GTGGGACTAGATTTATTTGGGGG - Intergenic
1054892113 9:70261959-70261981 GTGGAAGCAGAAAACTTTGCAGG + Intronic
1055416990 9:76094284-76094306 GTGGAAGCAAAAGCATTTGGGGG - Intronic
1055810473 9:80142635-80142657 GGGGCAGCAAAAATTTTTGGGGG - Intergenic
1056322038 9:85444405-85444427 GCGGGGGCAGAAATTTTTGACGG - Intergenic
1056838141 9:89974580-89974602 GTGGGAGAAGAATAATTTGAAGG + Intergenic
1057708264 9:97412927-97412949 ATGGGAGCAGAAAGATATGCCGG - Intronic
1057877138 9:98766795-98766817 CTGGGAGCATAAATCTCTGGAGG + Intronic
1060661034 9:125405411-125405433 GTGGGAGCAGGCCTATTTAGAGG + Intergenic
1061748410 9:132756949-132756971 TTGAGAACATAAATATTTGGGGG - Intronic
1203775796 EBV:72503-72525 GTGGTAGCAGAAGGTTTTGGGGG + Intergenic
1186626063 X:11295273-11295295 GTAAGAGCAGCAATATGTGGAGG - Intronic
1187112377 X:16314938-16314960 GTGCCAGCAGATCTATTTGGTGG - Intergenic
1187685060 X:21807816-21807838 TTGGGAGAAACAATATTTGGGGG + Intergenic
1187931282 X:24295657-24295679 GTGTGTGTAGAAATATTTGTAGG + Intergenic
1188209449 X:27404240-27404262 GTTGGAGCTGGAATATGTGGAGG + Intergenic
1188437479 X:30178898-30178920 GTGGCAGGAGCAATATTTGAAGG - Intergenic
1188786868 X:34357312-34357334 GGGGAAGCAGAAATATATGGAGG - Intergenic
1192286865 X:69747583-69747605 GTGGAAGCAGAAATATTGGTGGG + Intronic
1192795856 X:74423334-74423356 ATGGCAGTAGAAATATGTGGGGG - Intronic
1194000503 X:88422719-88422741 GTGGGAGTATATATATTTTGGGG + Intergenic
1194149462 X:90305467-90305489 TTGGGAGCATAAATATTAGTGGG + Intergenic
1194412449 X:93573708-93573730 TTAGGAGCAGATATATGTGGTGG - Intergenic
1194605372 X:95972926-95972948 GTGGTGGCAGCCATATTTGGAGG + Intergenic
1194696310 X:97055501-97055523 GTTGGAGCATATTTATTTGGAGG + Intronic
1195657031 X:107341618-107341640 GTGGGTGCAGAAATGTGGGGAGG - Intergenic
1195741166 X:108066050-108066072 GTGGGAGCAGCATGATGTGGTGG - Intronic
1196190618 X:112790647-112790669 GTGGGAGCAGAAATATTTGGAGG - Exonic
1197013020 X:121590068-121590090 GTGGTAGCAGAAAAATTTGATGG - Intergenic
1197296327 X:124723568-124723590 CTGGAAGCAGACATATCTGGTGG + Intronic
1198523143 X:137473020-137473042 GTGGCAGCAGAAAGAGTTAGAGG + Intergenic
1199986356 X:152954731-152954753 GAGGTAGAAGAAATGTTTGGGGG + Intronic
1200012635 X:153130855-153130877 CTGGAAGCAGAAACATTTGCAGG - Intergenic
1200026965 X:153269062-153269084 CTGGAAGCAGAAACATTTGCAGG + Intergenic
1200495838 Y:3882198-3882220 TTGGGAGCATAAATATTAGTGGG + Intergenic