ID: 1196193610

View in Genome Browser
Species Human (GRCh38)
Location X:112818496-112818518
Sequence AAACCAAGGCAGCCCGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196193604_1196193610 24 Left 1196193604 X:112818449-112818471 CCCAGGCTGGAAAAGGAAGCAGA 0: 1
1: 0
2: 2
3: 42
4: 459
Right 1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG 0: 1
1: 0
2: 0
3: 12
4: 85
1196193608_1196193610 -9 Left 1196193608 X:112818482-112818504 CCGTGATGTTGGGAAAACCAAGG 0: 1
1: 0
2: 0
3: 19
4: 154
Right 1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG 0: 1
1: 0
2: 0
3: 12
4: 85
1196193605_1196193610 23 Left 1196193605 X:112818450-112818472 CCAGGCTGGAAAAGGAAGCAGAT 0: 1
1: 0
2: 2
3: 41
4: 266
Right 1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG 0: 1
1: 0
2: 0
3: 12
4: 85
1196193603_1196193610 25 Left 1196193603 X:112818448-112818470 CCCCAGGCTGGAAAAGGAAGCAG 0: 1
1: 0
2: 4
3: 58
4: 544
Right 1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG 0: 1
1: 0
2: 0
3: 12
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196193610 Original CRISPR AAACCAAGGCAGCCCGTCAC TGG Intronic
901732460 1:11290153-11290175 AAATAAAGGCAGCCAGGCACGGG - Intronic
910445267 1:87293646-87293668 AGATAAAGGCAGCCCTTCACTGG + Intergenic
912113943 1:106380386-106380408 AAACCAAGGGGACCAGTCACTGG - Intergenic
916573845 1:166050150-166050172 AAAGGAAGGCAGCCCCTCAGAGG - Intergenic
919934015 1:202239627-202239649 AAACCAAGGCAGCATGTTAGTGG + Intronic
924749697 1:246874571-246874593 AATCCAAGGCAGCCTGGCAGTGG - Intronic
1065327961 10:24567325-24567347 ATATCCAGGCAGCCTGTCACTGG - Intergenic
1068661353 10:59626551-59626573 AAACCCACGCAGCCCTTAACAGG - Intergenic
1072721137 10:97781694-97781716 AAGCCAAGCCAGCCGGCCACAGG - Intergenic
1081615342 11:44587526-44587548 AAACCAGTGCAGCTGGTCACAGG - Exonic
1081765088 11:45604739-45604761 AAATCAAGGCATCCCCTCTCTGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1093898861 12:24606916-24606938 AAACCAAAGCAGCCCATCAAAGG + Intergenic
1095784449 12:46094206-46094228 AAACAAAGGCAGCCCCACCCTGG + Intergenic
1102148246 12:110670686-110670708 AAAGCCAGGCAGCCAGTGACCGG + Intronic
1103915911 12:124375655-124375677 AAACCCAGGCAGCCCGGTACTGG - Intronic
1106517338 13:30466194-30466216 AACCCAAGCCAGCCCCACACCGG + Intronic
1120503520 14:85325859-85325881 AAACCTAGGCAGCATGTCCCTGG - Intergenic
1122816454 14:104316453-104316475 AAGGCACTGCAGCCCGTCACAGG + Intergenic
1124034673 15:26044225-26044247 AAACCAAGACAGCCCATTACTGG - Intergenic
1132993297 16:2808540-2808562 AAACCCAGGCAGGCAGGCACTGG - Intergenic
1134070851 16:11258813-11258835 AAACCAAAGCTGTCTGTCACTGG - Intronic
1134250179 16:12568823-12568845 AGACCAAGGCAGCACCTCGCTGG + Exonic
1141617283 16:85217185-85217207 TATGCAAGGCAGCGCGTCACAGG - Intergenic
1141721215 16:85756315-85756337 AAGCCTCGGCAGCCCCTCACGGG + Intergenic
1144114825 17:12077854-12077876 AAACCAAGGCAGGACGCCTCAGG - Intronic
1148173817 17:45547351-45547373 AAACCCAGGCAGCCTGGCTCCGG + Intergenic
1148275451 17:46298096-46298118 AAACCCAGGCAGCCTGGCTCCGG - Intronic
1148297557 17:46515675-46515697 AAACCCAGGCAGCCTGGCTCCGG - Intronic
1148362109 17:47020154-47020176 AAACCCAGGCAGCCTGGCTCTGG - Intronic
1148597896 17:48871654-48871676 AAATCAAGGCAGGCATTCACGGG - Intergenic
1150405029 17:64894273-64894295 AAACCCAGGCAGCCTGGCTCCGG + Intronic
1150843103 17:68627927-68627949 AAACTTAGGCAGCCAATCACGGG + Intergenic
1151383321 17:73740356-73740378 AAACCCAGGAAGCCCGGCACTGG + Intergenic
1151968958 17:77447470-77447492 ACTCAAAGGCAGCCCGCCACAGG - Intronic
1155052767 18:22163349-22163371 AAACCCAGGCAGCCTGGCCCAGG + Intergenic
1156992250 18:43423304-43423326 AGACCAAGGCAGCCATTCCCAGG + Intergenic
1157825969 18:50812940-50812962 AAACCAAGGCAGTTTGTCACTGG - Intronic
1161592046 19:5133301-5133323 AAGCCAAGGCAGCCCGCCCCAGG - Intronic
1163603832 19:18263747-18263769 ACACCAAGGCAGGCCCCCACAGG + Intronic
1166254476 19:41592447-41592469 ACAGCAACTCAGCCCGTCACAGG + Intronic
925626705 2:5848441-5848463 TAAACTAGGCAGCCCCTCACAGG - Intergenic
926493629 2:13556927-13556949 AAACCTAGGCAGGCAGCCACAGG - Intergenic
927872963 2:26635239-26635261 AAACCAAAGCAGCCCTGGACTGG + Intronic
928742608 2:34372798-34372820 AAACCAATGCAGCCAGTCTGAGG + Intergenic
930805832 2:55489022-55489044 AAACCAATACAGACAGTCACAGG + Intergenic
935581424 2:104758915-104758937 AAACCAAGGCTGGCTGTCAGAGG - Intergenic
937980993 2:127615264-127615286 TAACCATGGCAGTCTGTCACGGG - Intronic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
1170554433 20:17504248-17504270 AAACCAAGTCATCACTTCACTGG - Intronic
1171209469 20:23305693-23305715 AAAGCCAGGGAGCCCCTCACAGG + Intergenic
1171399086 20:24860068-24860090 GAGCCAAGGCAGGCAGTCACTGG - Intergenic
1178669829 21:34580655-34580677 GAGCCAAGTCAGCCCTTCACAGG - Intronic
1181315407 22:21967911-21967933 AAAACCAGGCAGCCAGTCTCAGG + Intronic
1181639414 22:24188889-24188911 GAACCAAGGCAGCACTGCACTGG - Exonic
1183949896 22:41347114-41347136 AAACCCAGGCAGCCTGTCCCTGG + Intronic
950519023 3:13485321-13485343 AAACCAGGGCAGCCAAGCACTGG - Intronic
954182907 3:48895663-48895685 AAACCAAGGAAGTCCCTCTCTGG + Intronic
958423139 3:93950787-93950809 AAAGGAATGCAGCCCCTCACTGG + Intronic
958702924 3:97616173-97616195 AATCCAAGGCAACCAGGCACTGG + Intronic
961716024 3:128858022-128858044 TAACCCAGGCAGCCCTCCACTGG - Intergenic
961835587 3:129655817-129655839 AGACCAAGGCAGGCGATCACCGG - Intronic
962783660 3:138745635-138745657 AAAAAAAGGCAGCCCCTTACTGG + Intronic
967346759 3:188465742-188465764 AAAACAAGACATCCAGTCACAGG - Intronic
968220284 3:196932770-196932792 ATACCAAAGTAGCCAGTCACTGG + Exonic
976894379 4:90090929-90090951 AAAACTAGGGAGCCCGTCATGGG + Intergenic
978379224 4:108109397-108109419 AAACCCAGGCAGTCTGTCTCTGG - Intronic
986010567 5:3711043-3711065 CAATCAGGGCAGCCCATCACAGG - Intergenic
988842055 5:35092865-35092887 AAACCAAGGCAGCTAGCCACAGG - Intronic
991455566 5:66799794-66799816 CAACCCAGGCAGCCAGGCACTGG - Intronic
993660049 5:90622221-90622243 AGACCAAGGCAGCAGGTCACTGG - Intronic
994523709 5:100876537-100876559 AAACAAAGGAAGCCAGTCATTGG - Intronic
1001034525 5:168288222-168288244 AAAACAAGACAGCCTGTCTCAGG + Intergenic
1002334931 5:178471037-178471059 ATCCCAAGGCAGCCAGGCACTGG - Intronic
1004223724 6:13768458-13768480 AAACCAAGGCAGCCTGGCTCTGG + Intergenic
1005823269 6:29615622-29615644 AAAAAAAGGCAGCCAGGCACAGG + Intronic
1009422219 6:63475903-63475925 AATCAAAGGCAGCCCTTCAGAGG + Intergenic
1014193613 6:118526512-118526534 AAACCCAGGCAGCCCAACAAAGG + Intronic
1020601775 7:10283966-10283988 AACCCAAAGCAGCCTGTGACAGG - Intergenic
1024332662 7:48171550-48171572 AAACCAAGGCAAGCACTCACCGG - Exonic
1032090961 7:128911400-128911422 ATGCCAAGGCCGCCCTTCACTGG + Intergenic
1032291916 7:130596587-130596609 ACACCAAGGCAGCCAGCCAAGGG + Intronic
1033001743 7:137512938-137512960 AAACCAAGACAGCCAGAAACCGG + Intronic
1034992687 7:155558181-155558203 CAACCAAGCCAGCCCCTCCCAGG + Intergenic
1038657907 8:29470914-29470936 AAACCATGGCACCCAGTCTCAGG + Intergenic
1041953277 8:63528711-63528733 AAACCAGGGCAGCCTGACTCTGG + Intergenic
1042813397 8:72851011-72851033 AAACCAAGGCATCCAGACACAGG + Intronic
1043350161 8:79351265-79351287 AAACCTGGGCAGCACGTTACTGG + Intergenic
1044737505 8:95294395-95294417 AAACCTAGGCAGCCTGGCTCTGG + Intergenic
1048340934 8:133537851-133537873 AAACCATGGCAGCCGGCAACAGG - Intronic
1186029463 X:5352180-5352202 AAACCAAGGCAGCTTTTCTCTGG - Intergenic
1186111997 X:6267482-6267504 GAACCAATGCAGCCCGTACCTGG - Intergenic
1186336908 X:8599212-8599234 GAACCATGGCAGCCCTTCACTGG - Intronic
1188961435 X:36497285-36497307 TAACCAAGGCAGCATGGCACTGG + Intergenic
1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG + Intronic
1199376331 X:147114359-147114381 CAACCCAGGCATCCCATCACTGG + Intergenic
1201639393 Y:16162625-16162647 AAACCAAGGCAGCTTTTCTCTGG + Intergenic
1201663420 Y:16422702-16422724 AAACCAAGGCAGCTTTTCTCTGG - Intergenic