ID: 1196193610

View in Genome Browser
Species Human (GRCh38)
Location X:112818496-112818518
Sequence AAACCAAGGCAGCCCGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196193604_1196193610 24 Left 1196193604 X:112818449-112818471 CCCAGGCTGGAAAAGGAAGCAGA No data
Right 1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG No data
1196193608_1196193610 -9 Left 1196193608 X:112818482-112818504 CCGTGATGTTGGGAAAACCAAGG No data
Right 1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG No data
1196193603_1196193610 25 Left 1196193603 X:112818448-112818470 CCCCAGGCTGGAAAAGGAAGCAG No data
Right 1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG No data
1196193605_1196193610 23 Left 1196193605 X:112818450-112818472 CCAGGCTGGAAAAGGAAGCAGAT No data
Right 1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196193610 Original CRISPR AAACCAAGGCAGCCCGTCAC TGG Intronic