ID: 1196194375

View in Genome Browser
Species Human (GRCh38)
Location X:112824588-112824610
Sequence CTGGCTTCCAACTGTTGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196194375 Original CRISPR CTGGCTTCCAACTGTTGCGC TGG Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
912448755 1:109757242-109757264 CTGGCTTCCCACTTTTGCAATGG + Intronic
915660141 1:157398847-157398869 CTGGCTTCCAGCTATAGGGCTGG + Intergenic
916737719 1:167622826-167622848 CTGACTTGAAACTGTTGTGCAGG + Intergenic
921739271 1:218665473-218665495 CTGCCTACCAACTGTTGCCTAGG + Intergenic
922912098 1:229226520-229226542 CTGTCTTCCAACTGGGGGGCTGG - Intergenic
1067769651 10:49114314-49114336 CTGGCTACCAAGTGTAGAGCTGG - Intronic
1067851918 10:49759885-49759907 CTGGCTTCCAAGTACTGCCCAGG + Intronic
1068278627 10:54837844-54837866 CTGGCTACCAACTGTAGTCCTGG + Intronic
1069758169 10:70786569-70786591 CTGGCTTCATACTGGTGCCCTGG + Intergenic
1070776069 10:79110628-79110650 CTGGCTTCCCATTGTGGGGCTGG - Intronic
1074283011 10:112070828-112070850 CTGGTTTCCAAATGTTTCCCTGG + Intergenic
1077546432 11:3172349-3172371 CTGTCTTCCACCTGTTGGGGAGG + Intergenic
1084603110 11:70158331-70158353 CTGCCTTCAAGCTGTTGGGCTGG - Intronic
1085082846 11:73648245-73648267 CTGGCTTCAAACCGTTATGCCGG - Intronic
1087010631 11:93510736-93510758 CTGGCTTACATCTGTTGGGCAGG - Intronic
1090764336 11:129863831-129863853 CTGGTTTGCAACTCTTGCTCTGG + Intronic
1092033759 12:5312207-5312229 CTGGCTTCCATCTTCTGCCCAGG - Intergenic
1096500543 12:52061840-52061862 CTGGCCTCCAACTCTTGCTATGG + Intergenic
1101865782 12:108518396-108518418 CTGGCTTCCAACTTACCCGCTGG - Exonic
1104920471 12:132287927-132287949 CTGGCTTAAAACTATTGCCCAGG - Intronic
1106286551 13:28322986-28323008 CTGGTTTCCCACTGCTGTGCTGG - Intronic
1113454272 13:110437102-110437124 CTGGTTCCCAACTCTTGAGCAGG + Intronic
1119931514 14:78551986-78552008 CTGGCTTTCAAATGCTGCCCAGG - Intronic
1121926305 14:97930350-97930372 CTGGGTTCCAGCTGGTGCCCTGG - Intronic
1129248696 15:74296187-74296209 CTGGCTTACAAGTGTTGCATGGG - Intronic
1136624452 16:31453502-31453524 CTTGCTTCCTACAGTTGCTCTGG + Intergenic
1138263449 16:55642807-55642829 CTGGCTTCCTTCTGTTGAACTGG + Intergenic
1141000351 16:80301899-80301921 CTGACCTCCCACTGTTGGGCAGG - Intergenic
1142619782 17:1157650-1157672 TTGGCTTCCCCCTGTTCCGCTGG - Intronic
1143866402 17:9926802-9926824 CTGGCTTACAGCTGATGCCCTGG - Intronic
1151553729 17:74836321-74836343 GTGTCTTCCAGTTGTTGCGCAGG - Exonic
1155865162 18:30956045-30956067 CTGGCCTTCAACTGGTGAGCAGG + Intergenic
1159441486 18:68486049-68486071 CTGGGTTCCAACTGTTGGTTGGG - Intergenic
1160933546 19:1582368-1582390 GTGGCTTCCAGGTGTGGCGCAGG - Intronic
1167821034 19:51927719-51927741 CGGACTTCCAAGTGTTGCTCTGG - Intronic
934156470 2:89205590-89205612 CTGGTTTCCAAGTGTTGTGGAGG + Intergenic
934210847 2:89977169-89977191 CTGGTTTCCAAGTGTTGTGGAGG - Intergenic
939908645 2:147951383-147951405 GTGACTTCCCACTGTTGCACTGG - Intronic
941003372 2:160223325-160223347 CTGGTTTCCTACTATTTCGCTGG - Intronic
942731956 2:179069955-179069977 CTGGTTTACACCTGTTGCCCTGG + Intergenic
946863647 2:224023459-224023481 CTGGCTTCCCTCTATTGCTCTGG - Intronic
948359362 2:237408347-237408369 CTCTCTTCCATCTGTTGCCCTGG + Intronic
1171899581 20:30845099-30845121 CTGACTTCCTGCTGTTGAGCAGG - Intergenic
1175994650 20:62806697-62806719 CTGGGTCCCAATTGTTGCCCTGG + Intronic
1176065347 20:63191376-63191398 CTGGCTTCCTGCTGTGGCCCAGG - Intergenic
1177129665 21:17240738-17240760 TTGACTTCAAACTGTTGTGCTGG - Intergenic
1178257430 21:31067133-31067155 CTGCCTTCCAAATCTTGCTCAGG - Intergenic
1179095616 21:38311922-38311944 CTGGCTGCCAATTCTTGCCCTGG - Intergenic
1185050753 22:48552876-48552898 CTGGTTTCCCACTGTTGTGACGG + Intronic
950443228 3:13021981-13022003 CTGGCTGTCGACTGTTGGGCCGG - Intronic
954013605 3:47665151-47665173 CTGGGTTCCAACTGCTGCTCAGG + Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
959038127 3:101388210-101388232 CAGGCTTCTAACAGTTGTGCTGG - Intronic
960870095 3:122239443-122239465 CTGGCTCCCAACTGTGTCTCTGG + Intronic
961727938 3:128945145-128945167 CTGGCTTCCACCTGCTGGACGGG - Exonic
971960034 4:33473660-33473682 CTGGCTTCTGTCTGTTGCCCAGG + Intergenic
979043678 4:115834524-115834546 CTGACTTCAGACTGCTGCGCTGG - Intergenic
979751735 4:124287854-124287876 CTGGCTTTTAATTGTTGTGCTGG + Intergenic
1002332780 5:178455817-178455839 CTGGCTTCCTCCTGATGGGCGGG - Intronic
1005509543 6:26500269-26500291 CTGGCTTTTAACTTTTGCCCCGG + Intergenic
1006731589 6:36240117-36240139 CTGGCTTCAAACAGTTGCCCAGG - Intergenic
1007826423 6:44604363-44604385 CTGGCTTGCACCTGTTGTACTGG + Intergenic
1015789844 6:136955421-136955443 CTGGGTTCTAAATGTTGTGCTGG - Intergenic
1018562784 6:165119408-165119430 CAGGCTTTCAGCTGTTGCGTGGG - Intergenic
1021343434 7:19491510-19491532 CTTCCTTTCAACTGTTGCGTGGG - Intergenic
1024963483 7:55002696-55002718 CTGGCTTGCAGCTGTGGAGCAGG - Intergenic
1027267674 7:76503263-76503285 CTGGCTTCCAACAGCTTCCCTGG - Intronic
1027319486 7:77003126-77003148 CTGGCTTCCAACAGCTTCCCTGG - Intergenic
1035580607 8:737494-737516 CCCGGCTCCAACTGTTGCGCGGG - Intronic
1036071791 8:5448683-5448705 CTGGTTTCCTACTGTTGCAGTGG + Intergenic
1037264885 8:17047631-17047653 CTGGCTTCTGTCTGTTGCGATGG - Intronic
1037454293 8:19048118-19048140 CTGGCTGCCAACTGTGGCAGAGG - Intronic
1038200397 8:25407678-25407700 CTGGTCTCAAACTGTTGCCCAGG - Intronic
1039599965 8:38828017-38828039 CTCACTTCCAACTGTTGATCAGG + Intronic
1043503159 8:80875814-80875836 GTGGCTTCCAACTGTTGAACAGG + Intergenic
1047896786 8:129375014-129375036 CTGACTTCCTACTGTTGCAAGGG + Intergenic
1047996193 8:130338792-130338814 CTGACTTCCTACTGCTGCTCTGG + Intronic
1048833298 8:138496750-138496772 CTGGCCGCCAACAGTTGCGGCGG + Exonic
1051606720 9:18923930-18923952 CTGGCTTCAAGCTCTTGTGCCGG - Intergenic
1052249439 9:26380185-26380207 CTGGCTACAAACTGTTTTGCAGG - Intergenic
1052622326 9:30929566-30929588 ATGGCTTCTCACTGTTGCCCAGG - Intergenic
1058806714 9:108599801-108599823 CTGGCTTCCAACTGTGACTAGGG - Intergenic
1196194375 X:112824588-112824610 CTGGCTTCCAACTGTTGCGCTGG + Intronic
1199365245 X:146972662-146972684 CTGCCTTCCACCTTTTGGGCTGG - Intergenic