ID: 1196195109

View in Genome Browser
Species Human (GRCh38)
Location X:112831407-112831429
Sequence CTGTAGCCAGACATTGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 329}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196195108_1196195109 1 Left 1196195108 X:112831383-112831405 CCATAAACTTTTACTGAGCACTT 0: 1
1: 2
2: 13
3: 90
4: 512
Right 1196195109 X:112831407-112831429 CTGTAGCCAGACATTGTGCTAGG 0: 1
1: 0
2: 1
3: 28
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196195109 Original CRISPR CTGTAGCCAGACATTGTGCT AGG Intronic
902136940 1:14315269-14315291 TGGTTGCCAGACACTGTGCTAGG - Intergenic
902725703 1:18334711-18334733 CTGTATGCAGACCCTGTGCTCGG - Intronic
902812446 1:18896258-18896280 CTGTGGCCAGTCAGTGTGTTAGG - Intronic
903018802 1:20379387-20379409 CTGTAGACAAACATTGAGATGGG + Intergenic
903413532 1:23166735-23166757 CTGTACCCAGTAATTATGCTAGG - Intronic
904237986 1:29126103-29126125 CTGTGGGCAGACACTGTGCTGGG - Intergenic
904356072 1:29940791-29940813 CAGCAGTCAGACACTGTGCTGGG - Intergenic
904558019 1:31378090-31378112 CTATGGCCAGGCACTGTGCTAGG + Intergenic
905900490 1:41578859-41578881 ATGGTGCCAGACACTGTGCTGGG - Intronic
906176215 1:43775380-43775402 CATTAGCCAGGCATTGTGGTGGG - Intronic
906283278 1:44568464-44568486 ATGTGGCCAGGCACTGTGCTAGG - Intronic
906976921 1:50585623-50585645 ATGTAGCCAGATATCTTGCTTGG - Intronic
907525815 1:55053387-55053409 CTGTGGCCAGACATTGAGCAAGG + Intronic
907803468 1:57794747-57794769 AAGGAGCCAGACATTGTGCCAGG - Intronic
907823285 1:57991386-57991408 CCTTAGCCAGGCATTGTTCTGGG + Intronic
908368059 1:63447379-63447401 CTCTATCCAGGCACTGTGCTAGG + Intronic
908382424 1:63609281-63609303 CTGCAGCAAGACATTGGCCTGGG - Intronic
908391747 1:63689401-63689423 TTGTGGCCAGGCACTGTGCTAGG - Intergenic
908776313 1:67644359-67644381 CTGTAGCCAGTCCTTGACCTTGG - Intergenic
909471974 1:76039468-76039490 TGGGTGCCAGACATTGTGCTGGG - Intergenic
909634667 1:77804130-77804152 ATGCAGCCAGACTTTGTGCTGGG + Intronic
911467993 1:98278972-98278994 TTTGTGCCAGACATTGTGCTAGG - Intergenic
911473631 1:98349307-98349329 ATGTGGCCAGACATTATTCTTGG - Intergenic
911505136 1:98739463-98739485 CTATCACCAGACATTGTGCCTGG + Intronic
912413072 1:109491120-109491142 CTGTAGCCAGGCAGAGTGCATGG + Exonic
912488377 1:110047092-110047114 CTCTTCCCAGGCATTGTGCTGGG + Intronic
914998586 1:152566112-152566134 CTGGAGGCAGACACTGTACTGGG + Exonic
914999939 1:152579840-152579862 CTGGAGGCAGACACTGTACTGGG + Exonic
915001784 1:152600806-152600828 GTGGAGGCAGACACTGTGCTGGG - Exonic
915004373 1:152623022-152623044 CTGGAGGCAGACACTGTGCTGGG + Exonic
916502974 1:165402231-165402253 ATTTAGCCAGGCATTGTGGTGGG - Intronic
916588572 1:166167997-166168019 CAGGAGCCAAACATAGTGCTAGG + Intergenic
916693973 1:167218783-167218805 CTATGCCCAGGCATTGTGCTAGG + Intergenic
917663897 1:177205287-177205309 ATTTAGCCAGACATAGTGGTGGG - Intronic
917845467 1:179016428-179016450 CTGCAGCCAGCCACAGTGCTGGG - Intergenic
918127829 1:181599874-181599896 TTATAGCTAGGCATTGTGCTAGG + Intronic
919652253 1:200162131-200162153 CTTTGTCCAGACATTATGCTAGG + Intronic
919776486 1:201197444-201197466 CTGCAGCCCCACCTTGTGCTGGG + Intronic
920351733 1:205342473-205342495 CTGGAGCCTGGCACTGTGCTGGG + Intronic
920493297 1:206435968-206435990 GTATTGCCAGACATTGTGCTAGG - Intronic
920668910 1:207988002-207988024 CATGAGCCAGGCATTGTGCTAGG - Intergenic
920732396 1:208500022-208500044 ATTTAGCCAGGCATTGTGGTGGG + Intergenic
922464092 1:225834868-225834890 CTGTACCCAGGCATTCTGCTGGG + Intronic
922824105 1:228505361-228505383 CTGCAGCCAGCCATTCTGCTAGG - Intergenic
923719011 1:236451569-236451591 CATTAGCCAGACATGGTGGTGGG - Intronic
923809579 1:237298226-237298248 CTGGATGCAGGCATTGTGCTTGG + Intronic
1063602426 10:7494291-7494313 CATATGCCAGACATTGTGCTAGG - Intergenic
1063845166 10:10119539-10119561 CTTTACTCAGACATTGTGTTGGG - Intergenic
1064635046 10:17356954-17356976 ATGGAGCCAGACATTGTGAGTGG + Intronic
1065138389 10:22695775-22695797 CTGTGACCATACATTGTGTTAGG - Intronic
1067048281 10:42998041-42998063 GTTTGGCCAGACATTATGCTGGG + Intergenic
1068502629 10:57859398-57859420 CTGAAACCAGACAGTGTACTTGG - Intergenic
1068854427 10:61782872-61782894 TGGGTGCCAGACATTGTGCTAGG - Intergenic
1069403120 10:68070455-68070477 AAGTAGCCAGGCATTGTGGTGGG + Intronic
1070440115 10:76434919-76434941 CAGTAGCCAGGCACTGTGTTAGG + Intronic
1073864119 10:107782750-107782772 CTGTGGCCTGAGAGTGTGCTTGG + Intergenic
1073879822 10:107967780-107967802 TTTTGGCCAGACATTGTGCCTGG - Intergenic
1074372756 10:112913530-112913552 GTGTAGGCACACAGTGTGCTTGG + Intergenic
1074542443 10:114376269-114376291 CTATGACCAGACCTTGTGCTCGG + Intronic
1074716813 10:116227300-116227322 CTGTAGCCAGCCAATGCGCAGGG + Intronic
1074939213 10:118218410-118218432 AATTAGCCAGACATGGTGCTGGG - Intergenic
1075086410 10:119417130-119417152 CTGTCGCCTGCCCTTGTGCTTGG + Intronic
1075419154 10:122288076-122288098 CTTATGCCAGGCATTGTGCTAGG + Intronic
1075963899 10:126593799-126593821 TTGTTTCCAAACATTGTGCTTGG + Intronic
1077467846 11:2742037-2742059 CTGTTGCAAGACACTCTGCTGGG + Intronic
1077848624 11:6052516-6052538 CTATAGCCAGAAATTTTACTGGG + Intergenic
1078440049 11:11357219-11357241 CTGTAGACAGACCTTCTCCTGGG - Intronic
1081503486 11:43690279-43690301 CTGTGTACAGACATTGTTCTAGG - Intronic
1082802050 11:57421911-57421933 TTGGTGCCAGGCATTGTGCTTGG + Intronic
1082826427 11:57583155-57583177 AATTAGCCAGACATTGTGGTGGG - Intergenic
1084094793 11:66903974-66903996 CTGTAGCTGGGCATGGTGCTGGG - Intronic
1084461068 11:69296920-69296942 ATGCATCCAGACACTGTGCTGGG + Exonic
1084500584 11:69532842-69532864 AAGTAGCCAGACATGGTGGTGGG + Intergenic
1084826515 11:71735820-71735842 AAGTAGCCGGACATGGTGCTGGG + Intergenic
1084933747 11:72576102-72576124 CTGTTTGCAGACTTTGTGCTTGG - Intergenic
1085265229 11:75233958-75233980 TTCTGGCCAGACACTGTGCTAGG + Intergenic
1087212091 11:95454903-95454925 CTGCAGCCATAAATTGTGTTGGG - Intergenic
1089718708 11:120391069-120391091 TGGTAGTCAGAAATTGTGCTAGG - Intronic
1089833540 11:121349996-121350018 ATTGAGCCAGACACTGTGCTGGG - Intergenic
1090142584 11:124280296-124280318 CTGTGGTCAGAGAGTGTGCTTGG - Intergenic
1090295747 11:125586257-125586279 CTATAGCCAGGCACAGTGCTGGG - Intergenic
1091023484 11:132122112-132122134 CTGTAGCAAGCCATTGTGCTAGG + Intronic
1091434746 12:463482-463504 CTCGAGCCAGGCATTGTGCCAGG + Intronic
1092052067 12:5478859-5478881 ATGTGCCCTGACATTGTGCTGGG - Intronic
1092195049 12:6544313-6544335 AAGTAGCCAGGCATTGTGGTGGG - Intronic
1092308070 12:7322246-7322268 ATATTGCCAGACATTGTTCTAGG - Intronic
1094073337 12:26444464-26444486 TTGGAGGCAGGCATTGTGCTGGG - Intronic
1095253684 12:40008460-40008482 CATTAGCCAGACATGGTGGTGGG + Intronic
1096624247 12:52883928-52883950 ATGCAGACAGACATTATGCTGGG - Intergenic
1098979118 12:76936012-76936034 GTGTAGCCAGGCTCTGTGCTAGG + Intergenic
1099494124 12:83324066-83324088 CTGCAGCCTTACATAGTGCTTGG - Intergenic
1099619388 12:84981875-84981897 CTTTTGCCAGGCATTCTGCTTGG - Intergenic
1099668366 12:85659627-85659649 CTTTAGCCAGGCATGGTGGTGGG - Intergenic
1101360721 12:104024283-104024305 ATTTAGCCAGACATGGTGGTGGG + Intronic
1101697057 12:107136554-107136576 CTGTGGCCAGACACTGTTTTAGG + Intergenic
1101729820 12:107417726-107417748 CTGTGCTCAGACATTGTGCTCGG + Intronic
1101796610 12:107980806-107980828 TTTGAGCCAGACATTGTTCTGGG - Intergenic
1102699001 12:114823059-114823081 AAGTAGCCAGACATGGTGGTGGG - Intergenic
1103192069 12:119009730-119009752 CTGTATACAGGCACTGTGCTAGG + Intronic
1104056395 12:125234152-125234174 CTGTGGCCAGGGATAGTGCTGGG + Intronic
1105797152 13:23866558-23866580 CTGTAGACAGACCTTCTGCGCGG + Intronic
1106359575 13:29018273-29018295 CTTTAGCCTGTCATTGGGCTGGG + Intronic
1106903760 13:34383348-34383370 CAGTAGGAAGACAGTGTGCTTGG - Intergenic
1107017633 13:35720560-35720582 CATGAGCCAGGCATTGTGCTGGG - Intergenic
1108245007 13:48505245-48505267 TTGCACCCAGACATTGTGCCTGG - Intronic
1108691212 13:52860880-52860902 TTTTAGCCACACATTCTGCTAGG + Intergenic
1110323627 13:74188266-74188288 CTATACCCAGACACTGTTCTAGG + Intergenic
1111862961 13:93731185-93731207 CTGTAGTCAGTGATAGTGCTAGG + Intronic
1112532476 13:100218318-100218340 CCATAGCCAGACATGGTGGTGGG - Intronic
1112921686 13:104621408-104621430 ATTTAGCCAGGCATGGTGCTGGG - Intergenic
1113756569 13:112815923-112815945 CTCTTGCCAGACATTCTGCTGGG - Intronic
1114141805 14:19920706-19920728 TTGTATACAGTCATTGTGCTGGG + Exonic
1114305492 14:21419637-21419659 CTGCAGCCAGACCCTGAGCTGGG + Intronic
1115207004 14:30918538-30918560 ATGGTGCCAGGCATTGTGCTTGG - Intronic
1115328577 14:32168995-32169017 CTGTAGCCAGGCATGGTGGTGGG - Intergenic
1115956964 14:38792114-38792136 CTGGGGCCTCACATTGTGCTTGG - Intergenic
1117568064 14:57016899-57016921 CGTTAGCCAGACATGGTGGTGGG - Intergenic
1119036510 14:71234133-71234155 TTCTAGCCAGGCACTGTGCTGGG + Intergenic
1119615234 14:76094588-76094610 CTGTGGCCAGACACCGTGTTAGG + Intergenic
1120900301 14:89569637-89569659 TTGAGGCCAGACATTGTTCTAGG + Intronic
1120963824 14:90149894-90149916 CTATGTCCAGGCATTGTGCTAGG + Intronic
1121728051 14:96167227-96167249 CTGGAGTCTGACATTGTGCCAGG + Intergenic
1121811606 14:96896135-96896157 TAGGAGCCAGACACTGTGCTTGG - Intronic
1122798863 14:104219983-104220005 CTGGAGTCAGACATGGTGCGGGG + Intergenic
1126721002 15:51579611-51579633 CTGGAGCCAGACATTCGGTTAGG - Intronic
1128286154 15:66438763-66438785 CAGGTGCCAGACACTGTGCTTGG - Intronic
1128656722 15:69468034-69468056 CTGAGGCCCGACATTGTGCTGGG + Intergenic
1129567597 15:76639972-76639994 CTGTAGCCATACATAGGCCTTGG + Intronic
1130321949 15:82849015-82849037 TTTGTGCCAGACATTGTGCTAGG + Exonic
1130359171 15:83165644-83165666 AAGTAGCCAGACATGGTGATGGG + Intronic
1133514856 16:6498626-6498648 ATATGGGCAGACATTGTGCTAGG - Intronic
1134653250 16:15927301-15927323 ATGTAGCCAGGCATAGTGGTGGG - Intergenic
1135146335 16:19966076-19966098 CGTACGCCAGACATTGTGCTAGG - Intergenic
1135614158 16:23896377-23896399 CTGTATGCAGACACTGTGCTAGG + Intronic
1135714605 16:24751703-24751725 TTTGAGCCAGGCATTGTGCTAGG + Intronic
1138225996 16:55295125-55295147 CAGATGCCAGACACTGTGCTGGG + Intergenic
1138271891 16:55701631-55701653 CTGTGGTCAGACATGGGGCTAGG - Intronic
1138427330 16:56944612-56944634 AATTAGCCAGACATTGTGGTGGG - Exonic
1139230020 16:65274623-65274645 CTGGAGTCAGACACTATGCTGGG + Intergenic
1140672199 16:77290466-77290488 CTCTGGCCAGGCATTGTGCTAGG - Intronic
1140770123 16:78195671-78195693 AATTAGCCAGACATGGTGCTGGG + Intronic
1140895693 16:79322537-79322559 TATGAGCCAGACATTGTGCTGGG + Intergenic
1141262635 16:82467738-82467760 CTGTAGTGAGTCACTGTGCTGGG + Intergenic
1143338411 17:6190721-6190743 CTCTTCCCAGACATTGTCCTTGG - Intergenic
1144830552 17:18128665-18128687 CTGTGGCCAGGCACAGTGCTGGG + Intronic
1145734271 17:27215700-27215722 TTGTAGCCAGGCATCGGGCTAGG - Intergenic
1145908812 17:28531079-28531101 CTGGAGTCAGACCTTCTGCTGGG + Intronic
1145988952 17:29066530-29066552 CAGTGGCCAGACTTTGTGCCTGG - Intergenic
1152246195 17:79185833-79185855 CTATATGCAGACAGTGTGCTCGG + Intronic
1152518898 17:80843894-80843916 CTGTTGCCAGCCTGTGTGCTAGG - Intronic
1153071695 18:1113362-1113384 CTGTATCCAGAGGTTTTGCTAGG + Intergenic
1154512674 18:15125047-15125069 ATGTATCAGGACATTGTGCTGGG + Intergenic
1156047103 18:32889201-32889223 TTGTAGCCAGACACTGTAATGGG - Intergenic
1156286871 18:35705439-35705461 CTATAGCCTGACATTGTGAAAGG - Intronic
1158466074 18:57691024-57691046 AAGTAGCCAGACATGGTGATGGG + Intronic
1161296706 19:3523822-3523844 CTGTGCCCAGGCATTGGGCTAGG + Intronic
1161616849 19:5275655-5275677 CATTAGCCAGACATAGTGGTGGG + Intronic
1161868768 19:6854288-6854310 CTGTGTGCAGACATTGTGCTGGG + Intronic
1163849412 19:19654867-19654889 CAGAAGCCAGGCATTGTGCCTGG + Intronic
1164882737 19:31748592-31748614 TTGTTGCCAAACAGTGTGCTAGG + Intergenic
1165033163 19:33013022-33013044 AATTAGCCAGACATTGTGGTGGG - Intronic
1166653956 19:44596571-44596593 ATGAAGCCAGGCACTGTGCTGGG + Intergenic
1167197153 19:48038060-48038082 ATTTAGCCAGACATGGTGGTGGG - Intronic
1167943864 19:52971598-52971620 CGGTAGCCAGGCATGGTGGTGGG + Intergenic
1168587558 19:57605864-57605886 CTGTGGACAGAAATTGTACTTGG + Exonic
925052489 2:828001-828023 CTGCAGCCAGACATCATGGTTGG - Intergenic
925303048 2:2830508-2830530 CTGCAGCCAGAAATGGTGCTGGG - Intergenic
926569500 2:14513954-14513976 CTGTGGCTAGACATTGGGCAGGG + Intergenic
926703363 2:15818969-15818991 ATGTAGCCAGGCATGGTTCTAGG - Intergenic
928738121 2:34316538-34316560 CTGAAGCCAGAGAATGTGCTTGG + Intergenic
928984097 2:37163975-37163997 ATTTAGCCAGGCATTGTGGTGGG - Intergenic
929509541 2:42555921-42555943 AAGTAGCCAGACATGGTGGTGGG + Intronic
929755985 2:44765268-44765290 GTGTAGTCAGACACTGGGCTAGG - Intronic
929755992 2:44765347-44765369 TGGTAGTCAGACACTGTGCTAGG - Intronic
930092056 2:47538124-47538146 CTGTGGCCAGGAACTGTGCTAGG + Intronic
930231012 2:48843801-48843823 CCATAGCCAGGCATTGTACTGGG + Intergenic
930735252 2:54772164-54772186 TTTGTGCCAGACATTGTGCTAGG + Intronic
931008807 2:57883356-57883378 TTTGTGCCAGACATTGTGCTAGG - Intergenic
932306109 2:70705254-70705276 CTGTGCCCAGATATTGTGTTGGG - Intronic
933192671 2:79353338-79353360 CTGTGGTCAGAAAGTGTGCTTGG + Intronic
934954519 2:98606506-98606528 CTGTAGGCAGAGATTATGGTTGG - Intronic
935141196 2:100354421-100354443 AATTAGCCAGGCATTGTGCTGGG + Intergenic
937683349 2:124668205-124668227 CTGTAGTCATACATTTAGCTAGG + Intronic
937939346 2:127273095-127273117 CTGTAGCCAGTCATTTTTTTGGG - Intronic
938512917 2:131969682-131969704 ATGTATCAGGACATTGTGCTGGG + Intergenic
939878071 2:147600124-147600146 CATGTGCCAGACATTGTGCTAGG - Intergenic
941307845 2:163892694-163892716 CTGCAGCCCGACAATGTGATAGG - Intergenic
941516466 2:166486346-166486368 ATGGAGCCAGACTTGGTGCTAGG - Intronic
941968954 2:171329132-171329154 CTGTAGCCAGGCATGGTGGTGGG - Intronic
942307215 2:174620635-174620657 CTATGGCCAGACCCTGTGCTAGG + Intronic
943705729 2:191032383-191032405 TTTTAGCCAGACATTGCTCTAGG + Intronic
945257808 2:207816786-207816808 CTGTGGGCAGCCATAGTGCTCGG - Intergenic
945424625 2:209684987-209685009 ATGGAGTCAGACATTGTGCTTGG + Intronic
945518961 2:210799430-210799452 CTTTAACCAGTCATGGTGCTTGG + Intergenic
946007855 2:216540866-216540888 CTATAGCCAGGCACTGTGCTAGG - Intronic
947665779 2:231904543-231904565 CTGCAGCCAGGTATTGTGGTGGG - Intergenic
947717087 2:232346344-232346366 ATGTAGCCAGACTTGGTGGTGGG + Intergenic
947722078 2:232376398-232376420 CTGTAACCAGACATTATGACAGG - Intergenic
1169491826 20:6077579-6077601 CTGTAGACAGAAAATGTGTTGGG - Intronic
1172488172 20:35312436-35312458 CTGTGGCCTGGCATAGTGCTTGG - Intronic
1172647158 20:36477770-36477792 CTGCATCCAAACACTGTGCTAGG - Intronic
1173622483 20:44447217-44447239 CTGTGACCAGACACTGTGCTAGG - Intergenic
1175533086 20:59687789-59687811 CCGTAGCAGGACACTGTGCTAGG + Intronic
1176780854 21:13193152-13193174 ATGTATCAGGACATTGTGCTGGG - Intergenic
1176971591 21:15272197-15272219 AAGTAGCCAGACATGGTGGTAGG - Intergenic
1177255720 21:18659980-18660002 ATGTAATCAGACTTTGTGCTTGG + Intergenic
1177463079 21:21438615-21438637 CTGTAGCAAGACTTTTTGGTTGG + Intronic
1177978532 21:27882261-27882283 ATGTATCAGGACATTGTGCTGGG - Intergenic
1178924451 21:36763171-36763193 AAGTAGCCAGACATGGTGATGGG - Intronic
1179078571 21:38148219-38148241 CAGGAGTCAAACATTGTGCTTGG - Intronic
1179288925 21:40001428-40001450 CTGTAGGCAGCCCTTGTGCCAGG + Intergenic
1181237079 22:21453971-21453993 AAGCAGCCAGACATTGTGGTGGG + Intergenic
1181654964 22:24289304-24289326 CTGTTGCCAGACATTCTTTTAGG + Intronic
1185146590 22:49140277-49140299 CTTTCTGCAGACATTGTGCTTGG - Intergenic
949461062 3:4294839-4294861 CTGTAGTCAGACACTGAGCGAGG + Intronic
951866089 3:27309708-27309730 TTTGAGCCAGGCATTGTGCTAGG + Intronic
952052371 3:29400058-29400080 CTCTAGCCAAATATTCTGCTTGG - Intronic
954424652 3:50437009-50437031 CTGCACACAGACATGGTGCTTGG - Intronic
955727467 3:61948414-61948436 CTATGGCCAGGCATTGTTCTAGG + Intronic
955863823 3:63360700-63360722 CAGTGGCCAGACAGTGTTCTAGG - Intronic
955985850 3:64573231-64573253 CTGTGCCCAGACACTGTGCTAGG - Intronic
957287700 3:78238506-78238528 TTATTCCCAGACATTGTGCTTGG + Intergenic
958970651 3:100606576-100606598 CTCAATGCAGACATTGTGCTAGG - Intergenic
959043070 3:101441287-101441309 CTGTAGCCATCCATAGTGGTGGG - Intronic
959692727 3:109217274-109217296 CCCCAGCCAAACATTGTGCTAGG - Intergenic
959804551 3:110535353-110535375 CTTTAGCCAGACGTCGTGGTGGG + Intergenic
960027235 3:113023168-113023190 CATTAGCCAGACATGGTGGTGGG - Intergenic
960431561 3:117575152-117575174 CTGGTGCCAGACATTGTCCATGG - Intergenic
961647114 3:128398524-128398546 CTGTTGCCAGAGATTCTTCTAGG - Intronic
962269073 3:133964893-133964915 CTGGTGCCAGACCATGTGCTGGG - Intronic
962468729 3:135686394-135686416 CTTGTGCCAGACACTGTGCTAGG + Intergenic
962674179 3:137741601-137741623 TTGGTGTCAGACATTGTGCTGGG + Intergenic
963045851 3:141102250-141102272 CTGTGGCCAGGCCCTGTGCTAGG + Intronic
964422717 3:156521158-156521180 GTATACCCAGACTTTGTGCTGGG + Intronic
964536036 3:157722950-157722972 CTGTGGCCCAAGATTGTGCTTGG + Intergenic
965352705 3:167634297-167634319 ATGTAGCAAAACATTGTACTAGG - Intronic
967028059 3:185581852-185581874 ATTTAGCCAGGCATTGTGGTGGG - Intergenic
967443338 3:189534988-189535010 CATGAGCCAGACACTGTGCTGGG + Intergenic
968972153 4:3801631-3801653 ATGTAGCCAGACATGGGGCAGGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970031057 4:11675225-11675247 CAGAAGCCAGACATAGAGCTTGG + Intergenic
972525219 4:39903604-39903626 CTCTTGCCACACATTGGGCTAGG + Intronic
972617915 4:40717994-40718016 CTGTAGCCTCCCATAGTGCTGGG - Intergenic
973177762 4:47228988-47229010 CTATTGCCAGGCACTGTGCTGGG + Intronic
973582079 4:52354013-52354035 CTTTTGCCAGATATTGTTCTTGG - Intergenic
974066429 4:57081762-57081784 CTGGAGCCAGACTTCATGCTGGG - Intronic
974330014 4:60466133-60466155 CTGTGGTCTGACAGTGTGCTTGG - Intergenic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
975888793 4:78999089-78999111 CTTTATCCATACATTGTGATGGG + Intergenic
977961118 4:103086914-103086936 CTGAGGCCAGGTATTGTGCTAGG + Intronic
978096469 4:104785135-104785157 CTGTGGACTGACATTGAGCTTGG + Intergenic
982305834 4:153929656-153929678 CTGTTGCTAGACATTGTTATCGG - Intergenic
983397069 4:167212388-167212410 AAGTAGCCAGGCATGGTGCTGGG - Intronic
984807295 4:183763448-183763470 CTTTAGCCAGACCTTGAGTTGGG + Intergenic
985255869 4:188069522-188069544 CTGGAGCCAGAAATTGGGTTGGG - Intergenic
986006253 5:3671615-3671637 CTGTGGCCAGGCTTTGTACTGGG + Intergenic
986616589 5:9623705-9623727 CAGCAGCCAGGCATTGTGCTGGG + Intergenic
987426082 5:17774342-17774364 ATTTAGCCAGACATGGTGGTAGG - Intergenic
990529238 5:56657437-56657459 CTGCTGCCAGACACTGAGCTGGG + Intergenic
991070655 5:62476031-62476053 CTGTGGGCAGACACTGTCCTGGG + Intronic
993382185 5:87220758-87220780 ATTTAGCCAGGCATTGTGGTGGG - Intergenic
993451447 5:88075660-88075682 CTGTGGCCCGAGAGTGTGCTTGG - Intergenic
993477796 5:88386648-88386670 CTGTACTCAGACACTATGCTAGG - Intergenic
997875965 5:137547319-137547341 CTATAGCCAGGCCCTGTGCTGGG + Intronic
998479649 5:142452105-142452127 CTCTATCCAGACAGTGAGCTGGG + Intergenic
998587904 5:143447620-143447642 CTTTGGCCATACACTGTGCTAGG + Intergenic
998643832 5:144041190-144041212 CTGCTGCCATCCATTGTGCTGGG - Intergenic
999367395 5:151032065-151032087 CTAATGCCAGGCATTGTGCTAGG - Intronic
1000384166 5:160658159-160658181 CTGTTGCCAGACACTGTACTAGG - Intronic
1000781715 5:165490786-165490808 CTTCAGCCAGACATTGTTCTAGG - Intergenic
1000802464 5:165746080-165746102 CTGTAGGCAGACATTTCACTCGG + Intergenic
1001108785 5:168878037-168878059 CTGTATGCAGAAACTGTGCTAGG - Intronic
1001210992 5:169810072-169810094 CAAGAGCCAGGCATTGTGCTGGG - Intronic
1001959309 5:175870934-175870956 CTGTGGCTGGACACTGTGCTGGG + Intronic
1001982689 5:176047432-176047454 CTGGGGCCAGGCGTTGTGCTGGG + Intergenic
1002234774 5:177796625-177796647 CTGGGGCCAGGCGTTGTGCTGGG - Intergenic
1003449911 6:6221112-6221134 CTGTGGTCAGGCATTGAGCTAGG - Intronic
1004509910 6:16277104-16277126 CTGCAACCAGACGTTGTGCACGG - Intronic
1004703725 6:18103360-18103382 CTGTAGCCAGTCAGGGTTCTGGG - Intergenic
1007097311 6:39221508-39221530 CAGGTGCCAGACATTGGGCTGGG - Intronic
1007655464 6:43448806-43448828 CTGTAGTCAGAAACTGAGCTGGG + Intronic
1008694190 6:54014831-54014853 TTGTTGCCAGACATTCTGTTAGG + Intronic
1010206869 6:73330326-73330348 ATTTAGCCAGACATGGTGGTGGG + Intergenic
1010577208 6:77546790-77546812 TTGTGGCCAAACATTGTGCTGGG - Intergenic
1011420473 6:87166484-87166506 CTTGTGCCAGACACTGTGCTGGG - Intronic
1012537698 6:100319124-100319146 CTTTTGCCAGACACTGTGTTAGG + Intergenic
1012967897 6:105695376-105695398 CTATTGCCAGGCATTCTGCTGGG + Intergenic
1013035081 6:106374301-106374323 CCTTAGCCTCACATTGTGCTGGG - Intergenic
1015101616 6:129488159-129488181 CATTAGCCAGACATGGTGGTAGG + Intronic
1016033800 6:139364374-139364396 CTGTAGCGAGCAATGGTGCTTGG + Intergenic
1017118556 6:151002380-151002402 ATGTAGCCAGGCAATGTACTAGG - Intronic
1017130047 6:151100447-151100469 CTGGAGCCAGATAAGGTGCTTGG - Intronic
1017939612 6:159040279-159040301 ATGCAGCCAGACAGTGTGGTGGG - Intronic
1019021410 6:168921628-168921650 CTGTGGTCAGAGAATGTGCTCGG + Intergenic
1019434427 7:1014867-1014889 CTGTAGACAGAATTGGTGCTCGG - Intronic
1019569427 7:1703899-1703921 CTGTCGCCGGACTGTGTGCTGGG + Intronic
1020292292 7:6731026-6731048 CTGTAGCCCGGCAAAGTGCTGGG - Intergenic
1021529880 7:21632402-21632424 TTGTAGCCCGACAATGTGATAGG - Intronic
1022324566 7:29319478-29319500 CTGGAGCCAGGCATGGTGCATGG + Intronic
1022536873 7:31103741-31103763 CTGTGGCCAGGCCCTGTGCTGGG - Intronic
1023647179 7:42330165-42330187 AAGTAGCCAGGCATTGTGGTGGG - Intergenic
1023871425 7:44264932-44264954 CTGGAGCCAGGCCTTGTGCATGG - Intronic
1026980352 7:74523068-74523090 CCTTAGCCAGACATGGTGGTAGG + Intronic
1028834648 7:95361076-95361098 CTTAAGACAGACATTGTGGTTGG + Intronic
1028997863 7:97121552-97121574 CTATTTCCAGACAATGTGCTAGG + Intronic
1031022196 7:116640415-116640437 CTTTATCCAGACATTGCCCTTGG + Intergenic
1031125434 7:117768415-117768437 AATTAGCCAGACATTGTGGTGGG + Intronic
1031147586 7:118014133-118014155 ATATAGCCAGGCATTGGGCTAGG + Intergenic
1031859834 7:126965965-126965987 CTATGGCCACACATTGTGCTAGG - Intronic
1032094384 7:128930323-128930345 CTTTAGCCAGGCATGGTGGTGGG + Intergenic
1034340310 7:150348925-150348947 ATGTAGCCAGGCATGGTGGTGGG + Intergenic
1035312086 7:157975837-157975859 CTGCAGACAGGCATTGTGGTTGG - Intronic
1036610676 8:10347196-10347218 CTGGAGCCAGACACGGTGCAAGG - Intronic
1036948807 8:13121520-13121542 ATGTAGGCAGGCATTGCGCTGGG + Intronic
1038098037 8:24337526-24337548 CTAAAGCCAGACACTGTGCTGGG - Intronic
1040522356 8:48189170-48189192 CTGTGCCAAGACATGGTGCTGGG - Intergenic
1041247028 8:55898158-55898180 CAGTTGCCAGGCATTGGGCTGGG - Intronic
1042054535 8:64749961-64749983 TTTGTGCCAGACATTGTGCTAGG - Intronic
1043588333 8:81795449-81795471 CTGGAGCCAAACTTTCTGCTGGG + Intergenic
1044435524 8:92158067-92158089 CTGTTGCCAGACCCTGTTCTAGG - Intergenic
1045760462 8:105600092-105600114 CAGTAGGCAAACATTGTGGTCGG - Intronic
1046427450 8:114073523-114073545 CTGTAGCCTAACATTGTGAAAGG + Intergenic
1047193357 8:122699076-122699098 CATTAGCCAGGCATGGTGCTGGG - Intergenic
1047429138 8:124775715-124775737 GTGCTGTCAGACATTGTGCTTGG + Intergenic
1048212856 8:132470125-132470147 CTGTTGCCAAACCTTGTGCCAGG - Intronic
1048320934 8:133399760-133399782 CTGTGGCCAGACACAGAGCTGGG + Intergenic
1048863760 8:138743725-138743747 CTTAATCCAGATATTGTGCTGGG - Intronic
1051280431 9:15437379-15437401 AAGTAGCCAGGCATTGTGATGGG - Intronic
1053515720 9:38729191-38729213 CTGTAGACCTGCATTGTGCTGGG + Intergenic
1053515828 9:38729934-38729956 CATTAGCCAGACATGGTGGTGGG - Intergenic
1053540305 9:38966832-38966854 CTGAAGCCAGACCTTTTGGTTGG - Intergenic
1053882930 9:42613775-42613797 CATTAGCCAGACATGGTGGTGGG + Intergenic
1053889739 9:42680527-42680549 CATTAGCCAGACATGGTGGTGGG - Intergenic
1054140634 9:61526473-61526495 CTGAAGCCAGACCTTTTGGTTGG + Intergenic
1054221954 9:62421245-62421267 CATTAGCCAGACATGGTGGTGGG + Intergenic
1054228760 9:62487928-62487950 CATTAGCCAGACATGGTGGTGGG - Intergenic
1054625837 9:67397091-67397113 CTGAAGCCAGACCTTTTGGTTGG + Intergenic
1055641590 9:78323014-78323036 CTGTACCCAGGCAGAGTGCTGGG - Intronic
1055696465 9:78890238-78890260 CTGTATCCAGACATTGCATTTGG - Intergenic
1056743044 9:89276420-89276442 TTGTAGCCTGACAATGTGATAGG - Intergenic
1057695681 9:97321618-97321640 CTACAGACAGGCATTGTGCTGGG + Intronic
1058178374 9:101765924-101765946 ATTGAGCCAGACACTGTGCTAGG - Intergenic
1058721454 9:107768369-107768391 CTGTATCCTGCCATTGTTCTGGG + Intergenic
1059337416 9:113577962-113577984 CTGCATCCAGACACTGTTCTAGG - Intronic
1185534565 X:850635-850657 CTGTACACAGTGATTGTGCTGGG + Intergenic
1186803533 X:13117176-13117198 CTTTAGCCACACAATGTTCTGGG - Intergenic
1190437458 X:50439824-50439846 CTGTAGACACTCATAGTGCTAGG + Intronic
1191019081 X:55841307-55841329 CTGTAACCAGTCACTGTGATTGG + Intergenic
1192153427 X:68726035-68726057 TTGCAGCCAGACATGGTGGTGGG + Intergenic
1192594463 X:72391955-72391977 CTATATGCAGGCATTGTGCTGGG - Intronic
1193065117 X:77251016-77251038 CTGCTACCAAACATTGTGCTGGG + Intergenic
1194212886 X:91090404-91090426 CTGTAGCCTGAGAGTGTGTTTGG + Intergenic
1195430106 X:104779567-104779589 ATGAAGCCTGACATAGTGCTTGG + Intronic
1196195109 X:112831407-112831429 CTGTAGCCAGACATTGTGCTAGG + Intronic
1197717057 X:129717157-129717179 ATGTTGCCAGGCACTGTGCTAGG - Intergenic
1197900273 X:131364224-131364246 CTGGGGCCAGCCATGGTGCTTGG - Intronic
1198301606 X:135339078-135339100 CTGTAGCCAGACAATTTCTTGGG - Intronic
1199004446 X:142678461-142678483 CATATGCCAGACATTGTGCTAGG + Intergenic
1199209155 X:145186525-145186547 ATTTAGCCAGACATTGTTCTAGG + Intergenic