ID: 1196198361

View in Genome Browser
Species Human (GRCh38)
Location X:112858439-112858461
Sequence TAGGGTAAACAGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196198354_1196198361 -2 Left 1196198354 X:112858418-112858440 CCAAGGTAAGAAGCACCTTACTA No data
Right 1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG No data
1196198351_1196198361 22 Left 1196198351 X:112858394-112858416 CCAAAGGAAGACTATGACAAAGA No data
Right 1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG No data
1196198350_1196198361 26 Left 1196198350 X:112858390-112858412 CCAGCCAAAGGAAGACTATGACA No data
Right 1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG No data
1196198353_1196198361 -1 Left 1196198353 X:112858417-112858439 CCCAAGGTAAGAAGCACCTTACT No data
Right 1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196198361 Original CRISPR TAGGGTAAACAGAGGGGAGA AGG Intergenic
No off target data available for this crispr