ID: 1196199745

View in Genome Browser
Species Human (GRCh38)
Location X:112872102-112872124
Sequence CTGTTTACACAAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196199745_1196199751 -4 Left 1196199745 X:112872102-112872124 CCCTCCTCCTTTTGTGTAAACAG No data
Right 1196199751 X:112872121-112872143 ACAGGGCAACACTTCATACCTGG No data
1196199745_1196199752 6 Left 1196199745 X:112872102-112872124 CCCTCCTCCTTTTGTGTAAACAG No data
Right 1196199752 X:112872131-112872153 ACTTCATACCTGGCTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196199745 Original CRISPR CTGTTTACACAAAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr