ID: 1196201041

View in Genome Browser
Species Human (GRCh38)
Location X:112886275-112886297
Sequence ATGCTGTTTTTGCTGACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196201041_1196201043 2 Left 1196201041 X:112886275-112886297 CCTTGAGTCAGCAAAAACAGCAT No data
Right 1196201043 X:112886300-112886322 ATATCCTCCGAAGCCAGAATGGG No data
1196201041_1196201042 1 Left 1196201041 X:112886275-112886297 CCTTGAGTCAGCAAAAACAGCAT No data
Right 1196201042 X:112886299-112886321 AATATCCTCCGAAGCCAGAATGG No data
1196201041_1196201044 3 Left 1196201041 X:112886275-112886297 CCTTGAGTCAGCAAAAACAGCAT No data
Right 1196201044 X:112886301-112886323 TATCCTCCGAAGCCAGAATGGGG No data
1196201041_1196201045 4 Left 1196201041 X:112886275-112886297 CCTTGAGTCAGCAAAAACAGCAT No data
Right 1196201045 X:112886302-112886324 ATCCTCCGAAGCCAGAATGGGGG No data
1196201041_1196201047 8 Left 1196201041 X:112886275-112886297 CCTTGAGTCAGCAAAAACAGCAT No data
Right 1196201047 X:112886306-112886328 TCCGAAGCCAGAATGGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196201041 Original CRISPR ATGCTGTTTTTGCTGACTCA AGG (reversed) Intergenic
No off target data available for this crispr