ID: 1196206912

View in Genome Browser
Species Human (GRCh38)
Location X:112950507-112950529
Sequence GACACTCTAGTGCTTAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196206907_1196206912 24 Left 1196206907 X:112950460-112950482 CCAATTGATTATGGAGCCTCAGC No data
Right 1196206912 X:112950507-112950529 GACACTCTAGTGCTTAAGGCAGG No data
1196206910_1196206912 -3 Left 1196206910 X:112950487-112950509 CCAGAGTTAGTGAGAAGATGGAC No data
Right 1196206912 X:112950507-112950529 GACACTCTAGTGCTTAAGGCAGG No data
1196206908_1196206912 8 Left 1196206908 X:112950476-112950498 CCTCAGCTTTACCAGAGTTAGTG No data
Right 1196206912 X:112950507-112950529 GACACTCTAGTGCTTAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196206912 Original CRISPR GACACTCTAGTGCTTAAGGC AGG Intergenic
No off target data available for this crispr