ID: 1196213573

View in Genome Browser
Species Human (GRCh38)
Location X:113023855-113023877
Sequence CTAAGCTCACCCAGGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196213568_1196213573 27 Left 1196213568 X:113023805-113023827 CCAGGGGAGCTGATGGTACTAAT No data
Right 1196213573 X:113023855-113023877 CTAAGCTCACCCAGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196213573 Original CRISPR CTAAGCTCACCCAGGCAGGC AGG Intergenic
No off target data available for this crispr