ID: 1196217702

View in Genome Browser
Species Human (GRCh38)
Location X:113072668-113072690
Sequence AGGGAGAGCTCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196217702_1196217710 25 Left 1196217702 X:113072668-113072690 CCCACAATCACTGAGCTCTCCCT No data
Right 1196217710 X:113072716-113072738 CGTGACACATGACCATTGCTGGG No data
1196217702_1196217709 24 Left 1196217702 X:113072668-113072690 CCCACAATCACTGAGCTCTCCCT No data
Right 1196217709 X:113072715-113072737 CCGTGACACATGACCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196217702 Original CRISPR AGGGAGAGCTCAGTGATTGT GGG (reversed) Intergenic