ID: 1196226405

View in Genome Browser
Species Human (GRCh38)
Location X:113172566-113172588
Sequence CAGATAAAACAAAAAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196226401_1196226405 -6 Left 1196226401 X:113172549-113172571 CCAATCTGTTAAGGGCCCAGATA No data
Right 1196226405 X:113172566-113172588 CAGATAAAACAAAAAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196226405 Original CRISPR CAGATAAAACAAAAAGATGG AGG Intergenic
No off target data available for this crispr