ID: 1196234396

View in Genome Browser
Species Human (GRCh38)
Location X:113261854-113261876
Sequence TGCCAGACTGTTTTTTAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196234396_1196234400 8 Left 1196234396 X:113261854-113261876 CCGATTTAAAAAACAGTCTGGCA No data
Right 1196234400 X:113261885-113261907 GTGGGATGGCTGCACTGTGCTGG No data
1196234396_1196234402 10 Left 1196234396 X:113261854-113261876 CCGATTTAAAAAACAGTCTGGCA No data
Right 1196234402 X:113261887-113261909 GGGATGGCTGCACTGTGCTGGGG No data
1196234396_1196234399 -6 Left 1196234396 X:113261854-113261876 CCGATTTAAAAAACAGTCTGGCA No data
Right 1196234399 X:113261871-113261893 CTGGCAGCTTTTCTGTGGGATGG No data
1196234396_1196234398 -10 Left 1196234396 X:113261854-113261876 CCGATTTAAAAAACAGTCTGGCA No data
Right 1196234398 X:113261867-113261889 CAGTCTGGCAGCTTTTCTGTGGG No data
1196234396_1196234401 9 Left 1196234396 X:113261854-113261876 CCGATTTAAAAAACAGTCTGGCA No data
Right 1196234401 X:113261886-113261908 TGGGATGGCTGCACTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196234396 Original CRISPR TGCCAGACTGTTTTTTAAAT CGG (reversed) Intergenic
No off target data available for this crispr