ID: 1196234402

View in Genome Browser
Species Human (GRCh38)
Location X:113261887-113261909
Sequence GGGATGGCTGCACTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196234396_1196234402 10 Left 1196234396 X:113261854-113261876 CCGATTTAAAAAACAGTCTGGCA No data
Right 1196234402 X:113261887-113261909 GGGATGGCTGCACTGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196234402 Original CRISPR GGGATGGCTGCACTGTGCTG GGG Intergenic
No off target data available for this crispr