ID: 1196234435

View in Genome Browser
Species Human (GRCh38)
Location X:113262104-113262126
Sequence GGCTCAGGAGATCCCCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196234435_1196234442 19 Left 1196234435 X:113262104-113262126 CCCACAAGGGGATCTCCTGAGCC No data
Right 1196234442 X:113262146-113262168 AGAAAAAGTGTGGATCCCCAAGG No data
1196234435_1196234440 9 Left 1196234435 X:113262104-113262126 CCCACAAGGGGATCTCCTGAGCC No data
Right 1196234440 X:113262136-113262158 AAAGATCCATAGAAAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196234435 Original CRISPR GGCTCAGGAGATCCCCTTGT GGG (reversed) Intergenic
No off target data available for this crispr