ID: 1196234846

View in Genome Browser
Species Human (GRCh38)
Location X:113267168-113267190
Sequence CTAGTTCTGCCGCTCACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196234842_1196234846 5 Left 1196234842 X:113267140-113267162 CCACCTCATTACTGCAACCATTC No data
Right 1196234846 X:113267168-113267190 CTAGTTCTGCCGCTCACTCCAGG No data
1196234841_1196234846 18 Left 1196234841 X:113267127-113267149 CCAAATTTATTGTCCACCTCATT No data
Right 1196234846 X:113267168-113267190 CTAGTTCTGCCGCTCACTCCAGG No data
1196234839_1196234846 25 Left 1196234839 X:113267120-113267142 CCCAAGGCCAAATTTATTGTCCA No data
Right 1196234846 X:113267168-113267190 CTAGTTCTGCCGCTCACTCCAGG No data
1196234843_1196234846 2 Left 1196234843 X:113267143-113267165 CCTCATTACTGCAACCATTCAAA No data
Right 1196234846 X:113267168-113267190 CTAGTTCTGCCGCTCACTCCAGG No data
1196234840_1196234846 24 Left 1196234840 X:113267121-113267143 CCAAGGCCAAATTTATTGTCCAC No data
Right 1196234846 X:113267168-113267190 CTAGTTCTGCCGCTCACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196234846 Original CRISPR CTAGTTCTGCCGCTCACTCC AGG Intergenic
No off target data available for this crispr