ID: 1196238892

View in Genome Browser
Species Human (GRCh38)
Location X:113316956-113316978
Sequence CTTGGAGCACTGACAGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196238889_1196238892 25 Left 1196238889 X:113316908-113316930 CCAACTTCTCTGGTGGTTGCACA No data
Right 1196238892 X:113316956-113316978 CTTGGAGCACTGACAGAACCTGG No data
1196238887_1196238892 27 Left 1196238887 X:113316906-113316928 CCCCAACTTCTCTGGTGGTTGCA No data
Right 1196238892 X:113316956-113316978 CTTGGAGCACTGACAGAACCTGG No data
1196238888_1196238892 26 Left 1196238888 X:113316907-113316929 CCCAACTTCTCTGGTGGTTGCAC No data
Right 1196238892 X:113316956-113316978 CTTGGAGCACTGACAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196238892 Original CRISPR CTTGGAGCACTGACAGAACC TGG Intergenic
No off target data available for this crispr