ID: 1196253182

View in Genome Browser
Species Human (GRCh38)
Location X:113485940-113485962
Sequence CCAGATGTATTGGAGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196253179_1196253182 -5 Left 1196253179 X:113485922-113485944 CCACTGAAAAGTCTGCTGCCAGA 0: 243
1: 502
2: 518
3: 393
4: 407
Right 1196253182 X:113485940-113485962 CCAGATGTATTGGAGCTGCTTGG No data
1196253175_1196253182 21 Left 1196253175 X:113485896-113485918 CCACTCTCTCCTGGCCTGTAAGG 0: 149
1: 390
2: 742
3: 3716
4: 6041
Right 1196253182 X:113485940-113485962 CCAGATGTATTGGAGCTGCTTGG No data
1196253177_1196253182 12 Left 1196253177 X:113485905-113485927 CCTGGCCTGTAAGGTTTCCACTG 0: 200
1: 417
2: 516
3: 663
4: 836
Right 1196253182 X:113485940-113485962 CCAGATGTATTGGAGCTGCTTGG No data
1196253178_1196253182 7 Left 1196253178 X:113485910-113485932 CCTGTAAGGTTTCCACTGAAAAG 0: 206
1: 422
2: 497
3: 494
4: 679
Right 1196253182 X:113485940-113485962 CCAGATGTATTGGAGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196253182 Original CRISPR CCAGATGTATTGGAGCTGCT TGG Intergenic
No off target data available for this crispr