ID: 1196253992

View in Genome Browser
Species Human (GRCh38)
Location X:113494351-113494373
Sequence GTAAATATCCTGTCATTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196253990_1196253992 28 Left 1196253990 X:113494300-113494322 CCAGTTAAAGGTAATCCAAACTC No data
Right 1196253992 X:113494351-113494373 GTAAATATCCTGTCATTTCTAGG No data
1196253991_1196253992 13 Left 1196253991 X:113494315-113494337 CCAAACTCTTCTAATTTATACAA No data
Right 1196253992 X:113494351-113494373 GTAAATATCCTGTCATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196253992 Original CRISPR GTAAATATCCTGTCATTTCT AGG Intergenic
No off target data available for this crispr