ID: 1196254480

View in Genome Browser
Species Human (GRCh38)
Location X:113500163-113500185
Sequence TGCCATTGCAGAATATGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196254480_1196254482 -2 Left 1196254480 X:113500163-113500185 CCTTGCCATATTCTGCAATGGCA No data
Right 1196254482 X:113500184-113500206 CATTTCCATTTTGTTGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196254480 Original CRISPR TGCCATTGCAGAATATGGCA AGG (reversed) Intergenic
No off target data available for this crispr