ID: 1196258004

View in Genome Browser
Species Human (GRCh38)
Location X:113545517-113545539
Sequence GCTTAGAGTGTGCTCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196258000_1196258004 18 Left 1196258000 X:113545476-113545498 CCAGTTGTGAAATTGCTCTTTGC No data
Right 1196258004 X:113545517-113545539 GCTTAGAGTGTGCTCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196258004 Original CRISPR GCTTAGAGTGTGCTCCACCC TGG Intergenic
No off target data available for this crispr