ID: 1196262744

View in Genome Browser
Species Human (GRCh38)
Location X:113603883-113603905
Sequence GCTTAAGCATGTGCATCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196262742_1196262744 11 Left 1196262742 X:113603849-113603871 CCTGTTCTGAGTACACAGTTAAC No data
Right 1196262744 X:113603883-113603905 GCTTAAGCATGTGCATCTTATGG No data
1196262741_1196262744 12 Left 1196262741 X:113603848-113603870 CCCTGTTCTGAGTACACAGTTAA No data
Right 1196262744 X:113603883-113603905 GCTTAAGCATGTGCATCTTATGG No data
1196262740_1196262744 13 Left 1196262740 X:113603847-113603869 CCCCTGTTCTGAGTACACAGTTA No data
Right 1196262744 X:113603883-113603905 GCTTAAGCATGTGCATCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196262744 Original CRISPR GCTTAAGCATGTGCATCTTA TGG Intergenic
No off target data available for this crispr