ID: 1196265874

View in Genome Browser
Species Human (GRCh38)
Location X:113646060-113646082
Sequence TCTAAGGTCCTCAATCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196265874_1196265878 1 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265878 X:113646084-113646106 TTTCAAGCCTACTGTGGAGGTGG No data
1196265874_1196265882 8 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG No data
1196265874_1196265880 7 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265880 X:113646090-113646112 GCCTACTGTGGAGGTGGAGGAGG No data
1196265874_1196265879 4 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265879 X:113646087-113646109 CAAGCCTACTGTGGAGGTGGAGG No data
1196265874_1196265883 17 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265883 X:113646100-113646122 GAGGTGGAGGAGGGAAAGATAGG No data
1196265874_1196265876 -5 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265876 X:113646078-113646100 TTAGATTTTCAAGCCTACTGTGG No data
1196265874_1196265877 -2 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265877 X:113646081-113646103 GATTTTCAAGCCTACTGTGGAGG No data
1196265874_1196265885 24 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265885 X:113646107-113646129 AGGAGGGAAAGATAGGAATAGGG No data
1196265874_1196265884 23 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265884 X:113646106-113646128 GAGGAGGGAAAGATAGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196265874 Original CRISPR TCTAAGGTCCTCAATCTTGT TGG (reversed) Intergenic
No off target data available for this crispr