ID: 1196265875

View in Genome Browser
Species Human (GRCh38)
Location X:113646076-113646098
Sequence ACAGTAGGCTTGAAAATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196265875_1196265885 8 Left 1196265875 X:113646076-113646098 CCTTAGATTTTCAAGCCTACTGT No data
Right 1196265885 X:113646107-113646129 AGGAGGGAAAGATAGGAATAGGG No data
1196265875_1196265884 7 Left 1196265875 X:113646076-113646098 CCTTAGATTTTCAAGCCTACTGT No data
Right 1196265884 X:113646106-113646128 GAGGAGGGAAAGATAGGAATAGG No data
1196265875_1196265886 21 Left 1196265875 X:113646076-113646098 CCTTAGATTTTCAAGCCTACTGT No data
Right 1196265886 X:113646120-113646142 AGGAATAGGGTGAGTTAAAATGG No data
1196265875_1196265883 1 Left 1196265875 X:113646076-113646098 CCTTAGATTTTCAAGCCTACTGT No data
Right 1196265883 X:113646100-113646122 GAGGTGGAGGAGGGAAAGATAGG No data
1196265875_1196265882 -8 Left 1196265875 X:113646076-113646098 CCTTAGATTTTCAAGCCTACTGT No data
Right 1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG No data
1196265875_1196265880 -9 Left 1196265875 X:113646076-113646098 CCTTAGATTTTCAAGCCTACTGT No data
Right 1196265880 X:113646090-113646112 GCCTACTGTGGAGGTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196265875 Original CRISPR ACAGTAGGCTTGAAAATCTA AGG (reversed) Intergenic
No off target data available for this crispr