ID: 1196265882

View in Genome Browser
Species Human (GRCh38)
Location X:113646091-113646113
Sequence CCTACTGTGGAGGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196265874_1196265882 8 Left 1196265874 X:113646060-113646082 CCAACAAGATTGAGGACCTTAGA No data
Right 1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG No data
1196265875_1196265882 -8 Left 1196265875 X:113646076-113646098 CCTTAGATTTTCAAGCCTACTGT No data
Right 1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196265882 Original CRISPR CCTACTGTGGAGGTGGAGGA GGG Intergenic
No off target data available for this crispr