ID: 1196276308

View in Genome Browser
Species Human (GRCh38)
Location X:113769375-113769397
Sequence CTTCCTCAGCGGAGTTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196276308_1196276312 2 Left 1196276308 X:113769375-113769397 CCTGAGAAACTCCGCTGAGGAAG No data
Right 1196276312 X:113769400-113769422 CCTAGGCTAAATGATATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196276308 Original CRISPR CTTCCTCAGCGGAGTTTCTC AGG (reversed) Intergenic
No off target data available for this crispr