ID: 1196277654

View in Genome Browser
Species Human (GRCh38)
Location X:113786627-113786649
Sequence CTAGATCCCCAAAAATGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196277654_1196277657 30 Left 1196277654 X:113786627-113786649 CCTCCGCATTTTTGGGGATCTAG No data
Right 1196277657 X:113786680-113786702 AAAAAGCCTAATACCTGATTGGG No data
1196277654_1196277656 29 Left 1196277654 X:113786627-113786649 CCTCCGCATTTTTGGGGATCTAG No data
Right 1196277656 X:113786679-113786701 AAAAAAGCCTAATACCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196277654 Original CRISPR CTAGATCCCCAAAAATGCGG AGG (reversed) Intergenic
No off target data available for this crispr