ID: 1196291795

View in Genome Browser
Species Human (GRCh38)
Location X:113950484-113950506
Sequence CTATGCTGTTAGTACAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196291795_1196291797 -9 Left 1196291795 X:113950484-113950506 CCTGAGTTGTACTAACAGCATAG No data
Right 1196291797 X:113950498-113950520 ACAGCATAGGATCAAGAAGCAGG No data
1196291795_1196291798 6 Left 1196291795 X:113950484-113950506 CCTGAGTTGTACTAACAGCATAG No data
Right 1196291798 X:113950513-113950535 GAAGCAGGCAGCTCTTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196291795 Original CRISPR CTATGCTGTTAGTACAACTC AGG (reversed) Intergenic
No off target data available for this crispr