ID: 1196293749

View in Genome Browser
Species Human (GRCh38)
Location X:113976299-113976321
Sequence AGGCATATTAATAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196293749_1196293754 25 Left 1196293749 X:113976299-113976321 CCTTCCTTCCTATTAATATGCCT No data
Right 1196293754 X:113976347-113976369 ACGGTCTCACTATGTTCCCCAGG No data
1196293749_1196293753 6 Left 1196293749 X:113976299-113976321 CCTTCCTTCCTATTAATATGCCT No data
Right 1196293753 X:113976328-113976350 AAATTTTATTTATAAAGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196293749 Original CRISPR AGGCATATTAATAGGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr